Hello,
Do you have experimental or simulated secondary structures for your stocked mRNAs? Do you expect that the stocked mRNA would be folded or unfolded in your storage solution?
Hello,
I would like to load CleanCap EGFP mRNA into biological vesicles. Is that possible to remove (degrade) from the solution the unloaded CleanCap EGFP mRNA with RNAse?
Best regards,
What are the advantages of 5-methoxyuridine modifications? Are mRNA 5-methoxyuridine modified mRNAs more stable to RNAse degradation? Both in vivo and in vitro?
thank you!
Angeles
We want to use the CleanTag Small RNA library prep kit to sequence miRNA from plasma/serum but extract miRNA with automated extractor that elutes in 50ul final volume. So since the recovery amount is very low and also very dilute, is it possible to concentrate with vacuum or precipitate the RNA before proceeding? since the maximum initial volume is 2-10ul.
Do you have any other advice on this?
Hi!
How do you determine your mRNA concentration and which extinction coefficient do you use?
I am wondering if we need to include the sodium counterion in our molecular weight calculations of the mRNA or not and this depends on how you calculated the 1.0mg/mL concentration of some stocked mRNAs, because it influences, how many mRNA molecules or in that tube of that weight concentration.
I am interested in ordering CleanCap® FLuc mRNA (5moU) – (L-7202). What is the shelf life for the 5moU mRNA (at <-40oC, no F/T)? Do you ship it as powder or solution?
Is your “2′-Deoxynucleoside Alpha-Thiol Nucleotide Set – (K-1001)” available for reverse transcription using RNA templates? And, if available, how long can you extend cDNAs by? I’d like to perform RT reaction of 200~400 nt.
I cannot seem to find the method that is used for the purification of mRNA, could you give me this information? Is there a difference in methods if you order custom made mRNA compared to catalog mRNA’s?
Hi,
I want to order 5′-5′ inverted base(internal) modified DNA oligo. I know that 3′ end of inverted base modification blocks the PCR. Does the internal 5′-5′ inverted base in the template strand also block the PCR?
We bought some pseudo-UTP from TriLink and would like to add it during IVT. But I realized as we are using linearized plasmid as template, and the plasmid sequence just was cut a ~100 bp off to make it linear, which means it has extra sequence that do not contribute to mRNA synthesis. Will it affect the amount we need to use for pseudo-UTP modification? Or it better to use the linearized plasmid that only contains mRNA sequence?
Hello Trilink,
I will need to dilute Cre mRNA, provided by Trilink, for my electroporation experiments of mESC. What would you recommend using for the dilution? What handling procedures would you suggest while creating the dilutions?
Thanks,
Katharina
I am interested in making an RNA that does not possess a 5′ phosphate or cap structure (a simple 5′ hydroxyl is preferred). Can RNA be transcribed in vitro using T7 RNA polymerase and ApG dinucleotide as the initiator and the appropriate variant T7 promoter, analogous to using the CleanCap reagent, in order to generate RNAs that lack a 5′ phosphate? Will T7 accept the ApG dinucleotide for initiation from variant T7 promoters, and will this dinucleotide inhibit extension in any way in the process of transcribing the full length RNA. Many thanks, Andrew.
Our lab has been using CleanCap Cas9 mRNA – (L-7606) for gene editing in primary epithelial cells, but the gene editing has been very low (despite confirming that the transfection efficiency is not the issue). I was wondering if the CleanCap Cas9 mRNA (L-7606) has the following three particular modifications (which are said to decrease the immunostimulatory response and increase gene editing efficiency):
– Cap 1
– 100% Substituted/uridin-modified
– Purified to minimize double stranded RNA
The length of the Poly-A tail will determine the RNA degradation rate.
What’s the polyadenylation length TriLink adds and can it be shortened or lengthened on demand
Hi,
Regarding your CleanCap® OVA mRNA (5moU) – (L-7210) product, I was wondering if you tested if it is stable/functional after 1 freeze-thaw cycle? Or would you recommend to avoid the freeze-thaw at all?
Thanks!
Thank you for your question. Essentially, the 5-Methoxy-U (5moU) version (L-7201) has a full substitution 5MoU in place of Wildtype-U. 5MoU substitution has been shown to decrease innate immune response and increase translation efficiency. Please contact us at sales@trilinkbiotech.com with any additional questions.
Thank you for the inquiry and your interest in TriLink. Yes, TriLink does indeed offer manufacturing services to convert a client’s novel nucleoside into a nucleoside triphosphate. Please email the information requested below to sales@trilinkbiotech.com and we would be happy to further discuss your custom quotation.
1) Exact structure of the starting material
2) Desired starting scale (mg of nucleoside) or target final yield (umole of NTP)
3) Purity requirements, if known
4) Desired final salt form, if known
Hello,
I see that your company is able to synthesize a variety of oligonucleotides and is available for GMP and clinical studies. I was looking to find if you provide radiolabelled oligonucleotides but didn’t find any information. Do you not provide this service, and if not, do you have a recommendation for performing PK or other preclinical studies on non-radiolabelled nucleotides?
We are trying with difficulty to transcribe full 11kb RNAs from a DNA template using T7 and then we hope to perform double-strand cDNA synthesis on full-length transcripts in the resulting samples. Do you have some recommendations to assist with these steps? We do not want fragmented RNA.
Hello,
We are looking to source RNA that is sufficient quality for NMR study.
We’re following a protocol described in a paper, and it states “RNA was resuspended in water and precipitated with butanol to remove traces of small molecules resulting from the chemical synthesis.”.
Which purification methods would be most appropriate for this application?
Will 2’F NTPs be digested by RNase H when duplexed to an unmodified dNTP complement? On one page for an 2’F modified nucelotide, it is stated that RNase H will not process FRNA when duplexed with RNA. Im curious about RNase H processing when FRNA is duplex to DNA. Thank you
Dear TriLink,
I would like to acknowledge the receipt of 2-Aminoadenosine-5′-triphosphate in Lyophilized form. I would like to know how to prepare 100mM solution means just I have to add 50uL nuclease-free water?
Does Product A-9202 work with larger than 60 nucleotides molecules for the S-4FB molecules? The parameters say the yield would be lowered. I intended to use a 360 nucleotide molecules but fear the conjugate yield may be non existent.
Hi,
We’re interested in in-vivo (i.m/i.d.) delivery of mRNA.
We want to initially evaluate the delivery efficiency, and are thus interested in a control luciferase-encoding mRNA, to be monitored via IVIS.
Do you carry such ready-to-use mRNAs, or do I have to provide you with the relevant sequence to be synthesized?
Thank you in advance,
Uri
I am going to order an custom mRNA.
I will send my PCR product to TriLink and you guys will perform IVT.
My question is that what is the minimum amount of mRNA that I can order?
Sincerely,
Shin-Il Kim
Was wondering if you had a recommended ratio of rGTP to CleancapAG in capping reactions for in vitro transcription. Can CleancapAG be used with SP6 or T3 polymerase driven IVT reactions.
Hi,
If I want to introduce the modified NTP (such as pseudo-UTP, or 5moC) into my mRNA during IVT, should I replace all of the normal NTP with modified NTP for IVT? THX
We recently purchased CleanCap™ EGFP mRNA (L-7601-100) as controls for mRNA delivery experiments. I have transfected U87MG cells using lipofectamine 3000, and 2.5ug of mRNA transfect per small dishes. Control transfections using this cell line produce significant GFP and imaged by confocal microscope. We also want to do time-dependent GFP expression experiment. Can you tell us what is the minimum time need to express this mRNA transfection?
I am trying to generated IVT mRNA using 4-thio UTP within the reaction mixture but I have been unsuccessful in gernerating RNA using Thermo MEGAscript IVT kit.
Is 4-thio UTP able to be incorporated by T7 polymerase?
I am looking for adenosine tetra phosphate (ppApp) and/or adenosine pentaphosphate (pppApp) as a standard for HPLC analysis, I need very little. Do you have these or can you synthesize them?
Is it possible for CleanCap AG to degrade due to multiple freeze-thaw cycles? If so, how many freeze-thaw cycles can CleanCap AG undergo? Would RNA yield be effected if degraded?
Splicing changing oligos do work well in cell culture, but not in rat spinal cord
Dear Customer support,
we generated splicing changing oligos that work well in cell culture and mouse brain (18 mers, 2′-O-methyl-monophosphothioates) from you. However, they do not show efficacy in rat spinal cord. I went though the trouble to generate the rat reporter genes (rat DNA) and the oligos show efficacy in cell culture, but again not in rat spinal cord. The oligos are taken up, but no splicing change.
Is there another chemistry that you could recommend?
Have you heard of similar problems (I could not find anything in the literature), as these negative results usually don’t get reported.
Finally, we used to order all our RNA oligos from TRILINK, usually 2 weeks turn around. In the last two months, this went up to 2 months, which is not acceptable. Has this problem been solved?
thanks
stefan
Hi!
What is the guaranteed yield on a umoles order? I ask because at IDT the guaranteed yield is far lower than the yield order, and its dependent on the purification method used among other things.
I just wanted to know if without cloning we can directly sequence the selected aptamers to avoid loosing any important aptamer. Which sequencing platform should be used? What are the pros and cons of not cloning them?
I’m interested in trying your CleanCap reagent instead of ARCA. You state that an AG initiator is required for the CleanCap Reagent AG. Is this referring to for instance the “AG” where transcription is initiated in the T7 promoter sequence TAATACGACTCACTATAG, or something else?
Hi,
I need a DNA SELEX library of 40 random nucleotide and 17mer primer sites (around 100nmoles) with 3′ biotinylated primer and 5′ unmodified primer. I would like to know how much does it cost to ship to South Korea and how much does it cost.
Hi! I noticed my modified single strande RNA oligos (lyophilized powder) are always shipped at room temperature, sometimes it is an over the weekend shipment. I am wondering if this will affect the stability of my RNA oligos? What is the average storage time for RNA oligos powder at room temperature?
Hi,
What are the minimum requirements for shipping mRNA over a 24-48h period? Is there a minimum volume that it should be shipped at e.g. not less than 100 ul? Could a lower volume mean the mRNA is more susceptible to degradation?
Are there certain buffers that you always recommend?
Is there an easy assay that could be carried out each time the mRNA is used to determine whether any loss in quality has occurred?
Many thanks
Thank you for the inquiry. We routinely prepare aliquots of our mRNA in sizes as small as 20 uL @ 1 mg/mL, although we do not recommend aliquot sizes any smaller than 20 uL. We also ship all of our mRNA products in an insulated box on dry ice, and recommend storage at -40°C or below.
We formulate all of our catalog mRNAs in 1 mM Sodium Citrate, pH 6.4. We have found that this buffer provides both high solubility and stability of the mRNA when stored and handled properly. If you have identified a different buffer that you prefer, we can likely formulate the mRNA in that buffer for you as an alternative. We do recommend that single-use aliquots be prepared in order to minimize freeze-thaw cycles, which can cause degradation. To analyze the mRNA prior to use, we recommend confirming the length of the mRNA on a gel and/or bioanalyzer. If you have any additional questions or need further assistance please contact sales@trilinkbiotech.com.
Thank you for the inquiry. We can definitely assist you in creating a custom synthesis of this compound. Please contact our Technical Support team at sales@trilinkbiotech.com if you would like to discuss 6-Thio-2′-deoxyadenosine-5′-Triphosphate. We currently offer 6-thio-2′-deoxyguanosine-5′-triphosphate in our ready-made stocked catalog, but we do not have the adenosine analog stocked. Also, we are not familiar with an alternative commercial source for this material.
Hello, I would like to ask you if it is possible to use CleanTag Small RNA library prep kit also for piRNA sequencing or if the adapters bind only to miRNAs. Thanks a lot for your answer.
Hello Petra, CleanTag library preparation is a ligation based method that is designed to tag adapters onto small RNA species with a 3′ OH and 5′ P.
piRNA is thought to have this type of structure and would therefore be compatible with the CleanTag kit. If you have any additional questions or need further assistance please contact sales@trilinkbiotech.com.
Hi,
I am referred to your company by Lina Borozdina at AIC. I want to synthesize a branched structure DNA molecule, and this molecule is able to be conjugated with enzymes (ex. Horseradish peroxidase).
Lina told me your company should be able to help us with that. Can you let me know how to start and to get a quote? Thanks.
Hello
I bought oligonucleotide labeled with Black hole quencher 2
But is there any information about BHQ2 related with thermal stability?
I want to know in what environment BHQ2 can work successfully.
I will wait for your reply
Thank you
Here’s a pdf link to a publication on qPCR using BHQ2 that gives the following thermal cycling conditions during which BHQ2 is apparently stable enough for qPCR. The caveat is that using a different buffer/pH can alter thermal stability of BHQ2.
The amplication reactions were performed in the RotorGene 6000 (Corbett Research) under the following cycling conditions: 0th cycle at 95 C/15 min; then 45 cycles at 95 C/10 s, 55 C/25 s and 72 C/10 s. The fuorescence measurements were recorded at the detection step (55 C) during each of the 45 cycles
Hope this answers your question let us know if you require any more information!
Does custom oligo synthesis extend to dinucleotides or trinucleotides? For example, if one wanted GpAp or pGpAp or AppGpAp, would any of those be possible to order?
Hello Professor Collins,
We are able synthesize dinucleotides and trinucleotides. Please contact sales@trilinkbiotech.com for information or to obtain a quotation.
Best Regards,
Joey
Dear Madam, dear Sir,
Could you provide the precise sequence of a T7 promoter that can be used to incorporate CleanCap AG?
What is the functional difference between CleanCap AG and 3’methyl Clean Cap AG? Is one performing better as far as translation is concerned?
Thank you for the inquiry. We recommend using the following sequence for the T7 promoter for use with CleanCap AG, with the highlighted bases being the first three bases of the transcript.
TAATACGACTCACTATAAGG
Please also see below for some data comparing the different cap structures, including CleanCap AG and CleanCap AG (3’OMe). Please feel free to contact us at sales@trilinkbiotech.com for more information.
How long can we store a Clean Cap labeled mRNA assuming no RNase contamination? We need to run experiments in the future but would like to have the stock readily available. Should we order now, aliquot (carefully), and store at -80C? If so, how long should the un-thawed aliquots retain functionality? Thank you.
We have seen our mRNAs maintain stability for multiple years when stored at or below -40°C in Rnase-free conditions, although we do not report a formal expiration. We also recommend that you prepare single-use aliquots in order to minimize the number of freeze-thaw cycles, which should help maximize the integrity of the mRNA over time.
Hello,
I’ve just had some very encouraging results using your Cy5-mRNA for eGFP. Are you able to tell me what version of eGFP this is and do you know the protein half life?
Thank you
We are working on mRNA delivery, and now we are trying to test the protein expression in the liver. We have some problems with the detection methods, specially in the WB. We are working with your Cas9 mRNA, but finally the protein detected has a lower weigh as expected. We would like to know the exact molecular weight of the codified protein.
This is the reference that we use: L-7206.
Could this protein be in a truncated form?
How is conjugated fluorescein (6-FAM SE) to nucleotide in internally labeled oligo RNA? On your webpage there is only shown in which way 6-FAM is linked to 5′ end of oligo.
The exact structure would depend on which amino-modified base was used. For example, if 5-aminoallylcytidine was used, the structure would be like to the one found at the link below, but just replace cyanine-3 with fluorescein.
If you are developing a mRNA therapeutic that is based on a native sequence, wildtype nucleic acids with enzymatic capping, it is our understanding that you do not need to have a license. It should be noted that there are a number of modifications that are typically done to mRNAs to optimize their translation efficiency, stability and ease of transfection. Some of those technologies are covered by IP and would require the respective license. Also it should be noted that certain applications have IP concerns as well.
For all custom mRNA quotes we include the following note:
TriLink requires that all clients indemnify TriLink from legal action that may ensue from a custom synthesis. Because
TriLink manufactures many products at the request of its clientele, it cannot determine the patent status of each request.
I would like to order RNA oligo for fluorescence polarization assay. Should I choose e.g. a 6-FAM as internal label or maybe it is better to choose nucleotide with linker which will be fluorescently labelled?
In general, we recommend a more rigid attachment of the dye as extra rotational freedom and flexibility of the dye would generally reduce the effect of fluorescence polarization. The internal dye label in your oligo should lead to an increase in fluorescence polarization; however, this is dependent on your specific assay.
Hello. I found that you provide modified nucleotides that I am interested in- 5mdC, 5hmdC, 4mdC, 5fdC, 5cadC, N6mdA (item#s N2025,26,57,60,63,64). Do you also offer deuterium-labeled versions of these nucleotides?
Do you have a recommended ratio of EGFP mRNA (L-6301) to Cas9 mRNA (L-6125) if they are transfected together? I imagine they have different expression efficiencies and would like to prioritize Cas9 expression but maintain a suitable level of GFP expression to gauge electroporation efficiency.
Unfortunately we have not done this experiment before, but one of our senior scientists suggests that a 5:1 Cas/EGFP mRNA ratio might be a good starting point.
I would like to incorporate one 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) [N8004] at 3′ end of a double strand DNA blunt end with Klenow Exo- to obtain a T tail end with a phophorotioate bond. The expected final result :
–NNNNN*T-3′
–NNNNN-5′
Would it possible ? Do you think that the strategy is correct ?
The enzyme sounds correct and in general you should be able to end label your DNA however we’re not sure if it will work with a blunt ended DNA molecule.
You may have to create an overhang with your DNA and then add the Thio NTP as the enzyme is used to doing this to fill in a nick. It is possible you may get a low level of activity with a blunt ended DNA but we’re not sure.
-NNNNN -NNNNN*T
-NNNNNN-5’ -NNNNNN
I’d like to buy modified nucleotides to be used to replace common dNTPs in a PCR reaction. in particular I’d like to use une nucleotide modified with a quencher and another with a receiver to be used in a FRET reaction.
Can you make it? I have no ideas about the couples to be used as acceptor/donor
Thanks
This is currently not an item that we offer in our catalog, but we could potentially manufacture it as a custom synthesis. You can request a quotation via email (sales@trilinkbiotech.com) or through our online quote request form (http://www.trilinkbiotech.com/oligo/quote.asp)
Hi Andrio – We are able to synthesize CleanAmp Primers with a 5’ Biotin modification. Do to the addition of this modification, we do require RP-HPLC purification. Our Product Management team would be happy to provide a quotation for this synthesis. You can request a quotation via email (sales@trilinkbiotech.com) or through our online quote request form (http://www.trilinkbiotech.com/oligo/quote.asp). If you have any additional questions please do not hesitate to contact us.
On the CoA for Biotin dUTP, the methods of analysis for the ‘Manufacturing Lot’ are AX-HPLC, P NMR, H NMR, Mass Spec, and UV-Spec. What are the criteria for a ‘Pass’ for each analysis? The results simply state ‘Passes’.
No the Adatpers do not contain a UMI. In the past, we have tried adding randomer regions to different parts of the adapters, with one of the purposes being to have them there as UMI’s however they failed to inhibit adapter dimer formation as much as the current CleanTag adapters.
Although we do not know the exact reason, we speculate that the current modifications to suppress adapter-adapter ligation are influenced by their sequence context. Thus, when we alter the sequence even slightly, we do not see as strong of an adapter dimer suppression like we do now.
Hi Jed,
We do not offer custom formulations. Our standard custom mRNA is provided in RNase-free 1 mM Sodium Citrate, pH 6.4 and is not concentrated. If you would like the final mRNA product provided in a special buffer or at a specific concentration, this can be accommodated at an additional cost. Please inform TriLink at the time of quotation.
Yes, you can modify CleanAmp primers with a fluorophore such as Cyanine 3. You can request a custom quote by sending your sequences to sales@trilinkbiotech.com.
What is the longest RNA sequence that your company can chemically synthesize?
Are you able to incorporate nucleotides at site specific locations?
Can these specific nucleotides be deuterated, 13-C, and/or 15-N labeled?
For example, I would like a 300 nucleotide long RNA with nucleotide #100-110 completely deuterated and the rest of the nucleotides fully protonated.
We offer a couple options for RNA synthesis, depending on your construct.
1. Via our synthetic route, the maximum number of RNA bases is approximately 100-110 NT.
2. Via our transcription route, the minimum number of RNA bases is approximately 200 nt.
We are able to synthesize site specific 15N/13C isotope labeled oligos via our synthetic route, however we require that the customer supply the isotopic amidites. We recommend contacting Cambridge Isotopes for purchase of the amidites.
Via our transcription route, we can supply the necessary triphosphate, but site specific modifications are not possible.
If you would like a formal quote, please contact our Product Managers at sales@trilinkbiotech.com.
Dear Federica,
We recommend re-suspending oligonucleotides in aqueous, neutral solution. We typically store our Oligonucleotides in water for extended periods, however, buffer is also acceptable. The buffer you choose will depend on your application. We recommend a neutral pH buffer. Please let us know if you have any additional questions.
in the article published by NAR (Cycling of the E. coli lagging strand polymerase is triggered exclusively by the availability of a new primer at the replication fork. ) the question is in what specifically the dGDPNP that designed for this study purpose what is the components of this neucleotide analogue
Will the F. luciferase mRNA control (L-6307) work well with IVT kits such as the ThermoFisher 1-Step Coupled IVT reaction? We are thinking of using it as a control to probe for both S-35 Met incorporation and Luciferase activity.
Thank you for your email. We have never used the ThermoFisher 1-Step Coupled IVT kit but believe that our mRNA should be a suitable control as described.
Please let me know if you have any additional questions.
Hello,
We transfected eGFP transcripts (WT, 2-Thio-U, and alpha-thio-U) produced in October 2014. We cannot see GFP expression with none of the transcripts after 24h of transfection. Those transcripts were conserved at -80°C and thawed two times. The first time, we performed a non denaturating gel that revealed two major bands for each transcript (one was lower to the expected size and the other one was upper). A smear was detected from the loading well to the lower major band. Aliquots were performed for each transcript and one aliquot was thawed yesterday for transfection.
Could the pattern revealed by our non denaturating gel reflect RNA degradation and more than one year of storage at -80°C is it not long to preserve the complete integrity of our transcripts ?
I thank you very much in advance
Best regards,
Vincent
Thank you for your email. I don’t believe this is a sign of degradation since the molecular weight of the smear runs higher than the major bands. If your mRNA is prepared well and does not contain Rnases, you should be able to keep it at -80 for at least a year and freeze-thaw it multiple times without degradation. It is likely that the smear is due to structural changes of the mRNA during the freeze-thaw process. I would suggest using a denaturing gel system. Transcript length and integrity are confirmed via agarose gel analysis after glyoxal treatment.
Please let me know if you have any additional questions.
We would like to use CleanAmp dNTPs in our PCR but were unsure if they will de-protect efficiently at 92°C since that’s the temperature we’ll doing denaturation initially and at every cycle.
The CleanAmp(TM) dNTPs have a half life of 5 minutes at 95°C in PCR buffer. At 92°C the deprotection rate will be slightly slower however this temperature should allow deprotection of enough of the CleanAmp(TM) dNTPs to work in your PCR. If needed, you could extend the time of the initial denaturation. Please contact us if you have any additional questions.
Thank you for your question. We lyophilize our oligonucleotides in a lyophilizer or speed vac. Please let us know if you have any additional questions.
I am planning on using an SELEX approach for isolating an aptamer perfect for my target viral protein. I am comfortable with most of the procedures except for the target protein immobilization step. Do you provide any magnetic beads or anything that we could use for immobilizing our target protein on?
I was wondering if you had data regarding the typical level of template DNA contamination in your final in vitro transcription-derived RNA preps? I need RNA for use as a standard in an assay so I really need to limit the amount of DNA in the prep.
Dear sir/madam :
I am planing to do selex round. If i have ssDNA 25 random nucleiotids flanking by to primer biding site so totally 66mers. My targets protein will be MLL1. So i am wondering what are the factors to be considered regarding binding ratio of initial ssDNA library with protein and subsequent rounds. what should be the recommended binding ratio for the first and the following selex round?
This is something you should determine experimentally for your protein of interest and your library.
Our biologists have provided a few publications which describes a RNA and DNA selection protocol which may have additional information.
We recently purchased eGFP mRNAs (L-6101 and L-6402) as controls for mRNA delivery experiments. I have transfected HEK293 and DU145 cells using lipofectamine 3000 and PEI (5:1 weight ratio) and am unable to see GFP expression (by FACS) after 7 or 24 hours. By FACS (looking at cy5) the delivery looks good. I have tried both the labeled (L-6402) and unlabeled (L-6101) side by side and transfected 100 or 200 ng/well (96-well plate) into cells at about 50% confluency. Control transfections using these cell lines with a CMV-eGFP plasmid produce almost off-scale GFP expression when measured by FACS. Is there something wrong with my protocol and what is the timing and level of GFP expression I should expect in comparison to a plasmid transfection?
Dear Scott,
Thank you for your inquiry. I would suggest checking for mRNA degradation. Make sure you are using serum free reagents (ie Optimem) that are rigorously RNAse free. We use special pipets for mRNA and for example do not do minipreps or maxipreps with these pipets. RNasezap can be used to clean work surfaces and pipets. FACS signal from the Cy labeled RNA does not ensure that there was good delivery since the RNA could simply be trapped in an endosome. This experiment should work well in the 293 cells, we have no experience with the other cell line. Additionally, you make want to experiment with the timing. Though I would expect to see EGFP expression at your indicated time points, many factors influence expression and half-life. We and others typically see peak expression between 12-18 hours.
Thank you for your email. At the smaller scales, 15 umole and below, there is no guarantee of final yield. Each oligo has unique synthetic properties based on its sequence and modifications; therefore it is not easy to predict how much material will result from a particular synthesis.
Our general expectations for HPLC purified unmodified DNA oligonucleotides are as follows:
Hi
I want to conduct 3D PCR as desribed by Suspene et al. I have ordered DIT and dDTP from your company. Is 2-amino-2′-dATP the dDTP that Suspene is describing?
And is Pfu polymerase able to incorporate these nucleotides?
Thank you
Bernadette
Thank you for your interest in Trilink Biotechnologies. Your inquiry is being reviewed by our technical team. We will get back to you soon with more information.
Thank you for your inquiry. Yes, 2-amino-2′-dATP is the dDTP that Suspene describes. We do not know for sure whether pfu polymerase is able to incorporate these nucleotides but it probably doesn’t. We recommend trying NEB’s Therminator.
Please let me know if you have any additional questions.
Can your company synthesize an RNA oligomer 5′-GCGCGC-3′ using modified 7-ethyl-7-deazaguanine for all the guanosines and N4-ethyl-cytosine for all the cytosines.
Thank you for your interest in our modified RNA oligonucleotides. We can incorporate most commercially available phosphoramidate into an oligonucleotide or use a provided amidite. I was unable to find a source for the RNA version of the N4-ethylcytosine or 7-ethyl-7-deazaguanosine.
TriLink also offers custom amidite synthesis. This can be affordable if you foresee using the amidite frequently in the future to offset the total cost. Please contact us if you are interested.
I have submitted an order through your oligo builder form with more information. The mentioned nucleobases can be found in this article. http://www.ncbi.nlm.nih.gov/pubmed/18448471
Yes, I would like a formal quotation with those modified bases, but I would like to add more detail. The full sequence I would like is:
5′-CUUGCUGAAG*C*G*C*G*C*ACGGCAAG-3′
The stars after the nucleotides represent the desired modified sequence. All other nucleobases are normal. Is this possible?
Dear Joshua,
Thank You for your response, one of our Product Managers will be in touch soon to provide you with a formal quotation.
Best Regards,
Joey
Hi,
I ordered a RNA oligonucleotide with an internal 2-Aminopurine label. The oligonucleotide was PAGE purified and the final report says that the final salt form is Na+. Do I need to desalt prior to use? Is there any other procedure I need to do before working with the RNA?
Thank you for your question. Each custom oligonucleotide goes through a desalting step during the final processing before shipment to remove the excess salt and any remaining organic compounds. Some salt will remain as a counter ion to the negatively charged backbone.
DNA Template
5′ TAG GGA AGA GAA GGA CAT ATG AT(N20, N30 or N40) TTG ACT AGT ACA TGA CCA CTT GA 3′,
Forward Selection Primer
5′ TAG GGA AGA GAA GGA CAT ATG AT 3′
If the DNA library is single-stranded, how are the forward primers anneal to the single strand template library? Because sequences of forward primer are not complementary to the template library.
Please explain to me if I misunderstood something- Jaslan
Dear Jaslan,
We recommend use of the Forward Selection primer and the Reverse Selection primer to amplify the single stranded DNA template.
First the Reverse Selection primer will bind to the ssDNA template and create a complementary strand to which the Forward selection primer can then bind to.
DNA Template
5′ TAG GGA AGA GAA GGA CAT ATG AT(N20, N30 or N40) TTG ACT AGT ACA TGA CCA CTT GA 3′,
Forward Selection Primer
5′ TAG GGA AGA GAA GGA CAT ATG AT 3′
Reverse Selection Primer (20 nmoles)
PO DNA, 5′ TCA AGT GGT CAT GTA CTA GTC AA 3′
Hello,
I would like to know whether my calculations are correct on the mRNA oligo I ordered. It seems that we received only 0.2 umole when we ordered 1 umole. Could that be correct? On the certificate of analysis it says the “quantity in OD” is 57.2 Absorbance Units. The extinction coefficient is given to be 251.3 OD units/umole. If my calculations are correct, then we received 0.2 umole rather than the 1 umole ordered. Further, I measure the A260 to be 736.5 A260 units after bringing the sample up in 50 ul of water.
Thanks for your help,
Eileen Murphy (Brown University)
Thank you for your inquiry. I have reviewed your recent order and I have the following feedback to offer you. Your quotation was for a 1.0 mole starting synthesis scale. This is the starting amount for the synthesis, it does not reflect the exact amount of product that will be yielded.
Research scale oligonucleotides are sold (by convention) by the starting scale, not the delivered amount. The reason is that each oligonucleotide is different, and will result in different yields, although the cost of material and labor is equivalent for similar constructs with the same starting scale. Therefore, the price is based on actual cost. If you need a defined amount of an oligonucleotide, please note clearly on your order that you are ordering based on the final quantity. We will then determine the scale needed to deliver that amount and price your oligo accordingly.
Typically our yields for a 1.0 mole starting synthesis scale, purified oligo are about 30 -60 OD260 units, or ~1-2 mg. Yields vary greatly depending on modifications and even on the sequence itself.
Which “High Fidelity PCR Master Mix” would you recommend using with the CleanTag Ligation Kit for Small RNA Library Prep? I noticed your protocol uses more than the volume that comes with the TruSeq Small RNA kit, so I was wondering which PCR MasterMix have you found most success with?
Thank you for your question. We recommend the Q5® High Fidelity 2x Master Mix (catalog # M0492S) from NEB for use with the CleanTag™ Ligation Kit for Small RNA Library Prep. You can view our full list of recommended reagents here.
Please let me know if you have any other questions.
Thank you for your interest in TriLink. We can synthesize the two strands separately and anneals them prior to shipment to provide a double stranded blunt end RNA. Due to the nature of the project, please email sales@trilinkbiotech with your sequences, synthesis scale and requested purification to begin.
Thanks for contacting us. We can ship lyophilized RNA oligos to New Zealand by FedEx International Priority. The estimated freight cost to New Zealand is $65. The freight cost is based on FedEx daily rates and can vary depending on the shipping address. Please note FedEx does not allow dry ice shipments to New Zealand, so any product requiring dry ice would need to be shipped through a specialized courier coordinated by you.
You can request a quote for your 10 nt RNA oligo in OligoBuilder®. Please let me know if there’s anything else I can help you with.
Thank you for you question. While TriLink does not develop or sell stocked aptamer sequences, I was able to find a publication from 2013 in the Neural Regeneration Research journal describing an aptamer against amyloid-beta peptide. Wang et. al. show that the TRX1-ABAD-DP-TRX2 peptide aptamer inhibits amyloid β peptide (Aβ) 42 toxicity and could lead towards a treatment for Alzheimer’s disease. Please let us know if you have any other questions.
Thank you contacting TriLink. At this time we do not synthesis peptide nucleic acids (PNA). Please let us know if there is anything else we can help you with.
We have the ability to synthesis most aptamers but do not offer any stocked aptamers. We do offer Aptamer Libraries for identification of aptamers via SELEX.
You can find stocked aptamers through other companies including Aptagen. Please let us know if you have any other questions.
Is there an advantage in using a c12 linker over c6 linker in coupling probes to magplex magnetic beads from Luminex. The objective is to develop a 34 target multiplex assay for detection of various viruses and bacteria using the MagPix instrument from Luminex. Thanks
Rachel
Thank you for your question. We suggest using the C12-amino linker as recommended in the Luminex probe/primer design manual. It is likely that the protocol was optimized for this linker.
Please let us know if you have any additional questions.
I just used your CleanTag Ligation Kit for Small RNA and I am trying to determine if the ligation/library prep was successful. Am I correct in assuming that I expect to see essentially no adaptor dimer formation in the prep? The TapeStation results show large (~2-4 ng/µl) peaks at around ~140bp for each sample (magnetic bead cleaned) and no obvious peaks at what would be the adaptor-dimer (~120bp).
I just wanted to confirm that because of the CleanTag chemistry, no adaptor-dimers form during ligation, and therefore, they aren’t amplified. Is this correct? If true, I should also be able to load these preps straight onto a sequencer with no gel purification of the 140bp band?
You are correct in that the CleanTag™ chemistry can fully suppress adapter dimer formation. If you are using very low input levels (less than 10 ng) you may start to see some adapter dimer but it should be minimal compared to amount of tagged library. Dilution of the adapters per the product insert is key to keep adapter dimer low at lower inputs.
Yes, you can load magnetic bead purified samples without gel purification directly onto a sequencer and get good quality sequencing data.
I just ran the samples on a Bioanalyzer DNA high sensitivity chip as well, and i am seeing a strong ~140-143bp peak, but I am also seeing a 130 bp peak on all my samples (including human brain reference/positive control).
Any idea what this is and if it’s cause for concern? I should say that I input about 100 ng total RNA for each sample, diluted the adaptors 1:2 but ran PCR for 16 cycles (not 12-15). Next time I will shorten the cycle length, but I just wanted to know what this 130bp peak was and if it will cause issues.
We often see a small peak on the Bioanalzyer® around 130 bp as a shoulder of the library peak at 140 bp. We do not know what this is yet. We have noticed that in other commercial kits which have a significant amount of adapter dimer the 130 bp peak often goes unnoticed because it is hidden as a shoulder between the library and dimer peaks. It often does not get called as its own peak. The product is more obvious when using the CleanTag™ Adapters because there is no adapter dimer to mask it. We haven’t found reason to be concerned as it didn’t seem to significantly detract from miRNA sequencing reads after doing just a bead based purification.
We are currently looking into what the 130 pb artifact is. One hypothesis is based on literature which shows evidence of usRNA (unusually small RNA) which are slightly smaller than miRNA.
I ordered a RNA sequence labeled with a fluorophore and a quencher from TriLink. Does the Extinction Coefficient provided in the Certificate of Analysis include the absorbance of the fluorophore and the quencher at 260 nm? In other word, is the RNA sequence the only factor that determines the provided Extinction Coefficient in this case?
Thank you for inquiry. Our calculation of the extinction coefficient involves the sequence, dyes and quenchers. We’re happy to discuss your specific sequence with you over email. Please expect an email from our Product Management later today.
Your technical report on oligonucleotide purity was very helpful. We use PAGE for size selection, but I was wondering if you comment on the error rate for substitutions, particularly for long oligos. Is it possible that the oligo will be of mixed composition, i.e. could 20% of the pool have the wrong base at a given position? Could you estimate the average number of errors one might expect in a 200mer and whether these could be mixed?
Thank you for your inquiry. We don’t calculate the error rate on a synthesis but based on historical information, the error rate you mention does not occur without being recognized and resolved. Our quality control on final products would show if there was high rate of substitution on a discrete sequence. An ESI-MS shows a single species to confirm synthesis of the correct product. If there was substitution as you mention, the data would be a skewed to look like a randomer.
Please let me know if you have any other questions.
Hello.
I am interested in an aptamer that would be able to detect a Salmonella typhimurium cell at one end and able to specifically hybridize to a ssDNA at the other end. Is it possible for you, and how difficult would that be for such an aptamer to achieve and maintain its 3D conformation in vitro?
Thank you for your interest in TriLink BioTechnologies, Inc. Unfortunately, we do not offer aptamer design or selection services. We recommend Base Pair Bio who should be able to help you with your research needs.
We can synthesize the aptamer once the sequence is determined. Please let us know once you have a sequence identified and we will gladly provide a quotation.
I would like to block ligation at the 3′ end of an oligo. The traditional way to block described in the literature is C3 spacer. I was wondering if I label the 3′ end of an oligo with the Cy5 dye, would the dye molecule effectively block ligation?
The blocking groups most often described in the literature are 3′ dideoxy-C, 3′ C3 Spacer (C3-OH) or 3′ Amino Linker (C6-NH2). All the mentioned modifications permanently block the 3′ hydroxyl group of the 3′ base. We can use the 3′ Amino Linker and label it with the Cyanine 5 dye which would continue to block the 3′ hydroxyl group.
Please contact us if you have any other questions.
Best regards,
Sabrina Shore, MS
Scientist, Research & Development
Hi,
I obtained a oligo from Trilink 47 bp in length with the presence of a random fragment that was 10bp.
Scale ordered: 0.2umole
Extinction coefficient: 457.1 units/umol
Od= 63.5
MW= 14334.9 g/mole
I calculated the molarity as umol= OD/extinction coefficieint
= 63.5/457.1= 0.138umol
To make 1mM of the oligo I added 138ul of water to the mixture.
Now total MW= 0.138 * 14334.9 = 1978.2ug
But as there are 138 ul each ul should have a concentration of 14.339 ug but each ul of my sample had 1ug concentration. Is there an error to my calculations?
Thank you for your inquiry. A final concentration of 1 uM means you have 1 μmole or 14.34 ug per mL. Concentrations should be confirmed with OD readings of the final solution. Please remember, the extinction coefficient and molecular weight reported is calculated average and the final values of a randomer oligonucleotide may vary.
We’re happy to discuss how to measure the concentration of you solution. Please email us to discuss measuring the absorbance.
Hi,
I want to add carboxyl-dCTP to the DNA fragments after RE digestion with Klenow. However, I saw that “5-Carboxy-dCTP is unstable in neutral and acidic conditions.” I wonder if 5-Carboxy-dCTP is stable in NEB buffer 2 (pH=7.9), or what is the best condition to do this.
Thanks.
Thank you for inquiring about 5-Carboxy-dCTP. The sensitivity to pH was determined during the synthesis. I have asked the chemist to review your question and provide any insights he may have.
Thank you for your patience during the holidays. 5-Carboxy-dCTP was functionally tested when it was added to our catalog.
In a single pase pair extension assay, 5-Carboxy-dCTP incorporated less efficiently than dCTP with Klenow using a buffer of pH 7.9. 5-Carboxy-dCTP was also tested in PCR amplification of a ~500 base pair Lambda gDNA in a pH 8.4 buffer. The PCR product formed with 75% substition of dCTP. Our chemists believe that 5-carboxy-dCTP should be stable enough in NEB buffer (pH 7.9) to be used with Klenow DNA polymerase but please remember to store the product at -20°C.
Please let me know if this provides adequate information for your experiments.
Hello,
I’m working with magnetic nanoparticles (10 nm) for hyperthermia approaches and I want to functionalize (coat) it with DNA (aptamer). what is the best conjugation method that could be used? please, i need a protocol indicating the type of DNA modification (e.g Thiol, Amine,… etc) and its corresponding surface functional groupe (e.g Hydroxide, Amine,… etc).
Thank You
Thank you for your inquiry. TriLink is able to offer different attachment chemistries. Based upon your application, we would match up the functional group on the oligo based upon the reactive group of the magnetic nanoparticles. Some possible chemistries include Thiol/Maleimide or NHS-ester/primary amine of a linker.
TriLink’s DADE (decanoic acid diester) linker offers a novel way of preparing conjugates more economically and with much more flexibility. We can readily prepare 5′ carboxyl linkers. This linker can be used to conjugate to amines using conventional carbodiimide chemistry. Though less convenient than the solid phase method described in DADE: A Pre-activated Carboxyl Linker, Applications and Methods, solution phase methods may be necessary at times. The DADE linker is also useful for conjugation to amine bearing molecules.
We can also employ other attachment chemistries if you can provide the reactive group on the nanoparticles. Please contact our Product Management group to continue the discussion.
I have ordered 5’end-modified RNA oligonucleotides and would now like to 3’end label them. Unfortunately, I cannot find any info on the nature of the 3’end of your RNA oligos. Is it a standard -OH group?
Thank you for your interested in our RNA oligonucleotides. You are correct, the 3′ end of an unmodified oligonucleotide would be the terminal base in your sequence with hydroxyl groups (-OH) on the 2′ and 3′ sugars.
We also offer a variety of linkers that can be used to have different chemistries on the 5′ and 3′ end of an oligonucleotide. You can use an amino linker for reactions with and activated carbonyl and a thiol linker for reactions with maleimides. The order of the chemistry performed is important as a maleimide will react with the free amine.
Hi, It’s my frist time to work with Elisa. My work was to quantify IgA in pig saliva by developing an Elisa (D-Elisa) and compare it with commercial Elisa kit (C-Elisa) as reference test. Results (IgA conc.) were pretty same by both elisa system with an acceptable inter-assay CV and intra-assay CV. I have some questions about the validation analysis of my D-Elisa.
1. How to calculate the relative sensitivity & specificity of D-Elisa with respect to C-Elisa?
2. IgA is predominant in pig saliva. But, In a few samples, both system couldn’t detect any IgA. Is it possible to consider those result as false negative? Or how to deal with these data?
3. For C-Elisa, LOD (15 ng/ml) was mentioned in the manual instruction. But How can I calculate LOD myself from the calibration curve? I also want to calculate sensitivity & specificity of C-Elisa. How can I do this if it’s possible?
4. In literature I found that cut off value is usually calculated to differ the positive & negative sample and this way to calculate sensitivity & specificity. But I tested all unknown samples. Do I need to calculate cut off value for my elisa?
(just to let you know) In C-Elisa:
Blank well (as background) : mean OD 0.0590 and SD 0.0056
zero standard: mean OD 0.0633 and SD 0.0035
Lower limit of Detection: mean OD 0.3925
Thank you for your questions. Unfortunately, TriLink does not have expertise in ELISA and we cannot provide you with an adequate answer. I have provided a link to a resource that may provide the information that you are looking for. I am sorry that we could not help you more.
I have been reading about aptamers, with the hope of working with them in our lab soon. As i understand, the three dimentional conformation taken up by an aptamer on binding to its target remains the same, through every batch of that aptamer synthesized. I could not however find an article about this. Could you help me with this please?
Thank you for your questions regarding aptamer conformation. Aptamer conformation is not straightforward, as a given sequence can take on multiple conformations. While some aptamers maintain one primary conformation, others do not. The secondary structure can depend on the actual sequence of the apatmer as well as external factors, including the pH and composition of the dilution buffer. In regards to whether aptamers can behave differently due to batch to batch variations, one can imagine a scenario where purity may influence structure and function. However, in general the synthesis should not affect aptamer conformation. Interestingly, we too were not able to easily find any online literature that specifically documents this phenomenon, though The Aptamer Handbook, edited by Sven Klussman presents a lot of useful information on aptamer activity, selection and design.
In order to obtain accurate concentration measurements using extinction coefficients provided by Trilink Biotech, what variables need to be held constant? I am assuming that extinction coefficients are determined experimentally by Beer’s law, when volume and path length are held constant. Can you provide details?
Thank you for your question. TriLink calculates the extinction coefficient of an oligonucleotide by using the nearest neighbor method and reports it on the Certificate of Analysis. You can learn more about extinction coefficients in our Technical Article, An Introduction to Extinction Coefficients and Molecular Weights of Oligonucleotides.
After diluting an oligonucleotide, the concentration can be determined by measuring absorbance with a spectrophotometer with UV lamp and quartz cuvette. Beer’s law can be used to calculate the concentration. If your oligonucleotide was supplied lyophilized, I recommend diluting to your preferred concentration using the method described.
Please let us know if you have any further questions.
Do you know if the aptamers of the SELEX library can distinguish between two peptides with a single aa change, between Gly and Pro. Is there any way compare the likelihood of a certain site to fit such recongnition? Is it different between 20/30/40 nt libraries?
Thanks- Eyal Fridman
Thank you for your interest in TriLink’s Aptamer Libraries. The complexity of the final library varies with the random region length. Libraries with longer random regions have more unique sequence motifs than libraries with shorter random regions. However, not all possible unique sequences can be represented in each selection. In contrast, libraries with shorter random regions will give you a better representation of all possible sequences but are inherently less complex than a library with a longer randomer region. However, once an aptamer is selected shorter aptamers are easier and less expensive to synthesize
Aptamers have been designed to bind to specific amino acids. Geiger et. al. found an aptamer that distinguished with a 12,000-fold improvement between L-arginine and D-arginine. I don’t know the specific discrimination between Proline and Glycine. It would need to be determined experimentally. Proline and Glycine have different structures but the location within the protein and the protein folding may affect the ability to find an appropriate aptamer.
I wish I had more specific information to share and good luck with your experiments.
Thank you for your interest in TriLink. Currently 2′,3′-dideoxycytidine is the only commercially available support. If you’d like to discuss your project, you can request a quote and our Product Management can review possible alternatives.
Dear Dr. Xusheng Qiu,
Thank you for your inquiry. We can prepare our triphosphates as the Li+, Na+ or TEA salt form. I believe our dDTP is currently in the Li+ salt form. I will have our technical support team contact you regarding preparing the Na+ salt form.
I would like to request quotation for a thiol-modified oligonucleotides. Is it possible to cross link the thiol-modified oligos to gold surface with succinimidyl 4-[maleimidophenyl]butyrate (SMPB)? What is the differences between 3′ C3, 3′ C6 and 3′ C6 Disulfide linker?
Thank you for your interest in TriLink’s custom oligo synthesis. The three thiol linkers you mention differ by the position on the oligonucleotide (5′ or 3′) and the linker length (3 or 6 carbon chain). The structure of the reduced thiol linker can be found on each product page. Thiol modified oligonucleotides are shipped as the protected thiol (for example, C6-S-S-C6, aka disulfide) to avoid dimerization. Prior to use, the disulfide can be reduced using TCEP. Thiol modified oligos can be ordered through OligoBuilder®.
Hi TriLink,
We are interested to order 5′ Maleimide-modified oligonucleotides to label them with a thiol-reactive reagent for RnD assays. If we supply the thiol-reactive reagent, do you are able to deprotect the maleimide, to make the conjugation with our reagent and to purify the conjugated product (by reverse-phase high-performance liquid chromatography, for example)?
Best regards,
Michael
Thank you for your interest in TriLink and the 5′ Maleimide-modifier. TriLink specializes in working closely with our customers for the individual requirements of each project including working with customer supplied material for various types of reactions.
A Product Management Specialist will be in contact via email to discuss the specifics and technical aspects of your project.
I want to order some primers for the detection of mtDNA damage in both rat and human. There are some mitoPrimers™ Available in the website of your company, such as A1, B1 or C1. I want to know that do these primers work for both rat and human? Thanks!
Thanks for asking about our mitoPrimers™. mitoPrimers™ were designed based on the Hypervariable 1 and 2 regions of human mtDNA to prevent any cross-species amplification between species.
I compared the A1 and CA mitoPrimers™ to the Rattus norvegicus mitochondrial genome and found that the A1 mitoPrimer™ aligns with two mismatched base pairs. The C1 mitoPrimer™ did not align. I would recommend you compare the primer sequences to your specific rat genome using BLAST to determine if the mitoPrimers™ are compatible.
Please do not hesitate to contact me with any further questions.
Best regards,
Sabrina Shore, MS
Senior Research Associate
Do you synthesize random nonamer with a 5′ DNP modification, similar to the Cy3 or Cy5 random nonamer that was used with NimbleGen labeling methods, except with dinitrophenol (DNP).
Thank you for asking about our stocked oligonucleotides. We do not offer a 5′ DNP random nonamer but you can order one using OligoBuilder®. The DNP modification can be found within the Non-Fluorescent Conjugates subsection of the Modification menu.
Please let me know if you have any other questions.
Thank you for your inquiry. I believe that you are referring to the elements needed in your transcription template to create a functional mRNA. These are located upstream or downstream from your open reading frame (gene). If this is what you are referring to, I have listed the elements below.
Your mRNA transcription template must include:
1. Promoter, preferably the T7 promoter
2. 5′ untranslated region with a strong Kozak sequence
3. ORF beginning with a start codon and ending with a stop codon
4. 3′ untranslated region
5. Poly(A) track top strand (this is not the same as a poly(A) signal)*
6. Unique restriction site at the end of the cassette that is suitable for linearization
*Most plasmids designed for expression in a eukaryotic cell contain a poly(A) signal rather than a poly (A) stretch. If you do not have a poly(A) track in your plasmid a poly(A) tail must be added through a poly(A) polymerase reaction.
If this is not the information you were seeking, please email info@trilinkbiotech.com and our technical team will assist you.
Best Regards,
Brea
Brea Midthune, Ph.D.
Business Development Analyst II
The problem I understand is the 4 Gs (starting at base 3) in a row will potentially cause synthesis issue. Also this G-quadruplex will potentially form undesirable secondary structure for PCR applications in the presence of potassium.
To mitigate, I learned that it’s possible to synthesize an oligo with a G analog, such as 7-Deaza-2′-deoxyguanosine to lessen the chance for the potential problems mentioned above.
If this analog indeed is the best course of action, what’s the best position(s) to insert this G analog, and how many to insert? However, I also read inserting multiple 7-Deaza-2′-deoxyguanosine could be problematic because 7-deaza-dG is sensitive to the iodine-based oxidizer solution used in phosphoramidite-based DNA synthesis. So, a suggestion is to substitute 7-deaza-dG with 7-deaza-8-aza-dG, which I’m not sure you have available as an option.
I would very appreciate your thought on this matter.
Thank you,
Chun-Nan Chen, Ph.D.
CEO & Chief Scientific Officer
Single Cell Technology, Inc.
6280 San Ignacio Ave. Suite E
San Jose, CA 95119
Mobile: (408) 642-9741
Email: chunnan.chen@singlecelltechnology.com
Thank you for your interest in TriLink. Poly guanosine and deoxyguanosine stretches have the propensity to form tetraplexes (complexes consisting of four different strands all bound at the poly G region). These complexes are very tight and make oligonucleotide synthesis difficult.
The use of 7-deaza-dG during PCR reduces the secondary structure but, unfortunately, the 7-deaza-dG and 7-deaza-8-aza-dG amidites have the same innate properties as guanosine during oligonucleotide synthesis. Synthetic and processing capabilities would still be problematic. For multiple incorporations of 7-deaza-dG, CSO is recommended as the oxidizing solution to combat degradation.
TriLink has devised specialized protocols for multiple and/or consecutive insertions of guanosine or 7-deaza guanosine. Due to the complexity of manufacturing, there is typically reduced yield or purity compared to a sequence with better base distribution. The number of incorporations of guanosine, 7-deaza-guanosine and/or 7-deaza-8-aza- guanosine will determine the final effect.
I would recommend trying the unmodified compound before proceeding with the modified version as the cost of the modifications will lead to an overall higher price.
I am interested in the stocked aptamer libraries. I have two questions, firstly do you have any publications resulting from the stocked library and secondly with the NdeI and SpeI sites, do you know of a commercially available E.coli vector which has these multiple cloning sites?
Happy New Year!
I would like to order a DNA oligo which contains 12bp random nucleotides (Ns) in the middle, if I wish to have all 4^12=16777216 possible oligos, what synthesis scale order I should place with you guys? Can you tell me how could assure that? Thanks a lot!
Thank you for interest in our randomer service. The expected yield of our various scales can be found on the Phosphodiester Product Information. An 0.2 μmole HPLC purified, DNA synthesis typically yields 5-15 OD260 units which is 25-75 nmoles of final product for an oligo with an extinction coefficient of 200 OD260/μmole. 25 nmoles of product is equivalent to 1.5 x 1016 sequences. You would expect on average 9.0 x 108 copes of each of your ~1.7 x 107 possible sequences within the 25 nmole yield.
TriLink has done extensive research to optimize the “n” wobble (A, C, G, T) to achieve as close to a 1:1:1:1 equal ratio as possible in the final oligo product. We also offer an enzymatic digest assay which measures the base distribution of the final product. You can order your oligo through OligoBuilder® and include your yield requirement and if you are interested in an enzymatic digest in the Notes.
I have been trying to make mRNA through in vitro transcription while substituting U with pseudouridine and C with 5-methylcytidine. However, yields are much lower than when using all natural nucleotides, and 260/280 is 1.5 instead of about 2.0 I get when using natural nucleotides, and the RNA looks shorter on gel. In an earlier question by Peizhe Wang, you suggest avoiding freeze thaw cycles and RNAse contamination by aliquotting the nucleotide mix into several tubes before using any for RNA synthesis, but I did that before I saw that suggestion here. I don’t have enough of the modified nucleotides to optimize the reaction very well on my own, so I need a better starting point. I have been using the Ambion T7 megascript kit, and it works fine for natural nucleotides, I have been getting 100 – 150ug RNA per reaction. Do you have any suggestions for making it work well with modified nucleotides?
Thank you for your question. The inclusion of modified bases in a transcription can alter several parameters. If you are including ARCA in the reaction and reducing the GTP (e.g. 4:1 ARCA:GTP) in order to give good capping, this will reduce your expected transcription yields by about 3-4 fold. In our hands, full substitution of U and C with pseudo-U and 5-methyl-C do no significantly reduce transcription yields. For an ARCA capped mRNA, fully substituted with pseudo-U and 5-methyl-C we typically see crude yields of 1.5-2 mg/ml of transcription. We optimize transcription reactions by varying the MgCl2 concentration. 4-6 mM over total NTPs usually works well.
With regards to the 260/280 ratio, the extinction coefficients and lambda maxes of pseudo-U and 5-methyl C differ from U and C. The lambda max for pseudo-U is 265 vs 262 and 5-Methyl-C is 279 vs 271. Thus, pseudo-U and 5-methyl-C substitution would be predicted to give you a higher 260/280 ratio than normal NTPs. If you are observing a lower 260/280 ratio, this might mean that you are actually doing a better job of removing protein in this prep. I would not be concerned by this.
With regard to mobility, we do sometimes see that some modifications change the mobility of the RNA on gels. Base modification can change the secondary structure of the mRNA and thus the mobility on non-denaturing gels. We recommend glyoxal treating the mRNA with NorthernMax®-Gly Loading Dye and then running it with NorthernMax® 10X Running Buffer (do not use TAE or TBE).
I hope this information is helpful. If you continue to have problems, you could considering order a custom mRNA.
Best regards,
Anton McCaffrey, PhD
Principal Scientist
You can order a synthesis of each of the oligos you need through our OligoBuilder® system. OligoBuilder® will provide a price based on the scale and purification required. If you unsure of the scale, you can include the amount of material needed in the comments sections.
Do you recommend making an OD320 or OD340 subtraction correction when calculating the concentration of an oligo solution? I am specifically interested in measuring the concentration of T16 oligo accurately. Thanks.
Thank you for contacting TriLink with your question. Our Director of Manufacturing does not recommend making a subtraction correction. Please contact us if you have any other questions.
I wanted to follow up specifically on your question regarding the T16 oligo. Since T absorbs at 260 nm, we recommend taking concentration measurements at that wavelength. If you are trying to employ a subtraction correction for a specific buffer, I recommend contacting us so we can discuss your exact situation.
For the 3′ biotin TEG modification, is the biotin TEG directly off the 3′ end? Or is there an intervening phosphate, such as is pictured for the 5′ modification?
If not, is it possible to have the 3′ end first phosphorylated and then modified with the biotin TEG?
Thank you for your questions. The 3′ Biotin TEG modification does include a phosphate group between the TEG linker and the first nucleotide in your sequence. We look forward to helping you with your project!
Thanks for the question. I discussed this with our research chemists and biologists. We found a paper by Clark et. al. which studied the affect of different analogs on DNA methyltransferase. While they showed that dG and 7-deaza-dG will inhibit methyltransferase to a similar extent, they did not review the scenario where dC is upstream from 7-deaza-dG. The findings show that dG and 7-deaza-dG have similar properties and therfore, dC followed by 7-deaza-dG may be tolerated by the DNA methyltransferase. The only sure answer can be found by experimental testing. Please let me know if you’d like to discuss this further.
Dear TrilinkBiotech staff,
I recently bought carboxyl dCTP and tried wiith different polymerases however I was unable to amplify my construct. I tried also C, meC, hmC, fC and they worked fine with AccuPrime, but nothing to do with caC. What do you suggest? Any advice on which polymerase I can use?
Thank you in advance
Thank you for contacting TriLink. I am not aware of any specific enzyme which is known to incorporate 5-carboxy-dCTP however; since different analogs incorporate with different efficiencies, I recommend performing some initial PCR experiments using natural:modified dNTPs in ratios such as 1:0, 3:1, 1:1, 1:3 and 0:1 to identify the best conditions. Alternatively, decreasing the elongation temperature, increasing elongation time in PCR cycle, increasing concentration of dGTP and 5-carboxy-dCTP or adjusting the pH may support incorporation. Please keep in mind this modification is sensitive to pH and should be kept in basic conditions. Do not hesitate to contact us if you have any further questions.
Dear Sir,
My husband has cancer. A Japanese chemist friend of ours, Alan Kono, sold Oligo Powder in the 1990’s. If I remember correctly, people had remission from cancer. Do you know how much powder to mix with liquid (water) and how many times a day? I still have some powder sealed. I know first hand it was an amazing product. Please respond.
Sincerely,
Beryl
I am very sorry to hear of your husband’s illness. Much of the research I conducted in my career has been directed towards the development of drugs for the treatment of various cancers. It is a demon I have long sought to conquer. Unfortunately, our firm does not sell the product you are interested in. We make oligonucleotides, which are short fragments of synthetic DNA and RNA.
The oligo powder you refer to is a completely different type of product. I looked it up and found that the term “oligo powder” can refer to a wide range of different products. The term “oligo” is Greek for many, and is used in science to refer to compounds that have multiple units of the same molecule attached to one another to form chains. For instance, a very common “oligo powder” is made with oligosaccharide, a sugar. Another is oligo chitosan powder. Yet another is made from oligo proantho cyanidin powder.
As to your specific question regarding the preparation of the powder, I must admit to having no knowledge at all about it. I did a basic search of the literature and found this obscure link to a PhD thesis in the Netherlands that may refer to the science behind the use of oligosaccharide powders for medicinal use. It refers to work by Kono.
I also found this link which describes the uses of this particular powder, but no mention of a cancer application. It does give a maximum dosage of 30 g per day. The concentration in water is probably dictated by solubility properties and your husband’s palate.
My guess is that this treatment was never approved by the FDA and therefore has fallen into obscurity. Many useful products end up disappearing in this fashion.
I am sorry I cannot be of more help. I wish you and your husband the best of luck. Please let us know if you find the answer you seek.
Best regards,
Richard Hogrefe, Ph.D.
CEO/President
Do you have a nucleotide modification that I can use for PCR incorporation that prevents further DNA amplification but is also a reversible modification? I would like to only amplify my original template but later use the DNA for sequencing reaction.
Thank you for your question. The only analog that has the properties you described is our CleanAmp™ dNTPs. Although the protecting group will not be stable during the elevated temperatures of PCR, certain enzymes such as the Therminator series of enzymes can incorporate this type of analogs. However, incorporation would need to be performed at low temperatures, such as at room temp. Then, a heat activation step can be used to remove the protecting group.
Please let me know if you like to discuss further.
we are trying to introduce aptamers as sensitisers into electronic transducers. We are looking for an aptamer that can be immobilised onto a metal (not so important what metal), and selectively binds to a biomedically relevant analyte in aq. solution (saline, or buffer).
Thank you for your question. The first step is to identify the aptamer for the analyte of choice using one of the many selection protocols available. We recommend that you use a random library with no more than 40 random bases. Longer ones will yield aptamers that will be more difficult and expensive to prepare synthetically, especially if the aptamer is heavily modified. You can review our stocked libraries to see if one may be used during your selection.
Once you have the sequence, it is fairly easy for us to modify your aptamer with a reactive moiety for conjugation to a metal. For instance, we can put sulfur on the aptamer for direct conjugation to a gold particle. Once you have identified the metal(gold is well established in the literature) we can help with the decision regarding chemistry.
I hope this helped. Please contact us for more details.
Best regards,
Richard Hogrefe, Ph.D.
CEO/President
We are currently searching for an RNA with a Poly (A) tail that can be used in our RNase test kit. It would be a 3’ poly(A) tail that is added to the end of the pre-mRNA.
Is this a product that you currently manufacture and if yes would you be able to provide us with a pilot lot to assess within our test kit??
We are looking to move on this ASAP so any information you could provide would be greatly appreciated.
Thank you for your interest in our RNA transcription service. Please submit a quote request with the details of your project to initiate discussions with our Product Management Team.
I’d like to order a DNA (beacon type) with a quencher conjugated at 3′ and an amino modifiers C6 (MMT) at 5′. Do I have to activate the amine group so as to go further conjugation or the product is delivered with the ready-to-conjugate amine group?
Thank you for your interest in TriLink. A 5’ amine modified oligonucleotide will be delivered ready to conjugate to a succinimidyl ester.
Please keep in mind that TriLink can perform the conjugation and purify the final product for you. We can conjugate most commercial succinimidyl esters or one you supply.
When you are ready to order your oligo, please visit OligoBuilder®. If you would like TriLink to conjugate your succinimidyl ester, please submit a quote request. We look forward to working with you.
Thank you for contacting us. Vortexing is an acceptable method for dissolved your oligo. We recommended reconstituting oligonucleotides in a neutral pH buffer. Vortexing or pulse spin is acceptable to ensure there is no lyophilized solid remaining. Please contact us if you have any additional questions.
Dear Trilink,
I usually order (DNP-TEG)-labeled probes and the QCs are a PAGE and mass Spec analysis. Can you provide a purity level with each order, that I could use as a reference?
Thank you,
Aurelie
Thank you for your question. We run mass spec and PAGE analysis on every oligo ordered as part of our quality system. The PAGE analysis allows qualitative assessment and mass spec confirms identity. An HPLC or gel densitometry is required for quantification of purity. HPLC and other analytics can be requested at the time of order. If you are not sure which analytical would be best for your requirement, just ask!
In regards to the DNP-TEG labeled oligonucleotides, we recommend requesting an AX-HPLC analysis. If you have samples of the oligos previously synthesized, we can run an AX-HPLC on each. We look forward to continuing to work with you.
Thank you for your inquiry. We have synthesized 2′-O-Methyl RNA oligonucleotides with 35-sulfur labels in the past. Please submit a quote request to discuss your project.
I am currently working to synthesize biotinylated DNA probes, and I was hoping you could elucidate how you quantified the samples in “PCR incorporation of modified dNTPs: the substrate properties of biotinylated dNTPs” (http://www.trilinkbiotech.com/work/biotinwhite.pdf) Thank you.
Thanks very much for writing in with your question. In this whitepaper, we quantified the amount of amplicon formed as a function of the amount of input biotinylated nucleotide by gel densitometry. In particular, the percent amplicon yield for a given percentage of biotinylated nucleotide was normalized to an reaction which contained only natural nucleotides.
While this approach can be used to identify optimal reaction conditions that will allow for biotinylated nucleotide incorporation in PCR without sacrificing amplicon yield, this does not measure the amount of biotin in the PCR product itself. Should direct quantification of the biotin content be of interest, enzymatic digestion of the isolated product is one way to do this. Eadie, et. al. and Andrus, et. al. describe this technique in their publications.
Please let me know if you have any follow-on questions.
You state on your website that 6-FAM is less susceptible to photobleaching than other fluorescein dyes (http://ask.trilinkbiotech.com/?page_id=124). Where can I find the reference for this?
Thank you for your interest. Photobleaching of different fluorophores has been reviewed for use in a number of applications including quantitative microscopy and fluorescence photobleaching recovery (FPR). Dailey, et. al. reviewed studies of photobleaching in different systems, as well as different methods employed to reduce photobleaching.
While 6-FAM is less susceptible to photobleaching than FITC, newer dyes have been developed that are more stable. For example, Panchuk-Voloshina, et al. demonstrated the stability of Alexa Dyes over FAM and FITC.
Please contact us if you would like to discuss the best fluorophore for your projects.
i want to prepare a primer with initiating an amino acid like –aa-n1-n2-n3—–
(n denotes a nucleotide).
which aa. is suitable and how can it prepare.
so after pcr amplifcation particular aa. used as biomarker
Thank you for your inquiry. An oligonucleotide modified with a 5′ adenylate can be coupled to a peptide via a N-terminal cysteine, aminooxy or hydrazide group on the peptide. This chemistry is described by Zatsepin et. al.
You can purchase your peptide from a variety of manufacturers including PolyPeptide, Sigma or AmbioPharm. A more comprehensive list can be found at Peptide Resource. Please let us know if you have any additional questions.
Thank you for your interest in TriLink. While TriLink does offer some custom radiolabeling, our license does not allow for 35S labeling of nucleoside triphosphates. Currently TriLink offers 35S and 3H labeling of phosphodiester and phosphorothioate oligonucleotides.
We recommend contacting Moravek Biochemicals for other radiolabeling services. Here is a link to their website: http://www.moravek.com/
I am sorry I could not be of further assistance. If there is anything else I can help you with please let me know.
Thansk for your answer. I have put 1-thio-dATP at the ends of a dsDNA by klenow exo-. I was hoping to get dA-p-SS-p-dA by oxidation with a strong oxidative agent(H2O2 or KI). It seems based on your answer that this is unlikely. Do you have another product that I can use for coupling two ends of a DNA by a quick disulfide bond formation?
I asked our research team to review your request. Our scientisted reviewed our thio-labeled triphosphates and publications for a procedure that may work. A disulfide bond can be created between two ends of DNA if synthesized with terminal thiol linkers, however this is only applicable if you material can be synthesized using oligonucleotide chemistry. If you would like to further discuss your project in detail, I recommend sending an email to info@trilinkbiotech.com for discussions with our R&D team.
Thank you for your question. If there is a commercially available phosphoramidite or conjugate we can incorporate the material into an oligo. Our Product Management team is researching this modification. If the material is not commercially available, our custom chemistry group can synthesize an amidite for your use. In the meantime, if you could provide any references regarding the modification, we can review the options.
Hi,
I have a question regarding 1-thiol-dATP (N8001). I see that the product is kept in water. Isn’t that in the absence of DTT the S groups will form disulfide bonds?
Second, can this modified dATP be incorporated into a dsDNA by Klenow (or Klenow exo-)?
Best Regards,
Reza Afra
Reaserch Assistant in Dept of Physics
Purdue University
Thank you for your inquiry. 1-Thio-dATP (N-8001) will not form a disulfide bond in the absence of DTT. However, if it is degraded to the monophosphate version, there is an unlikely possibility to form symmetrical dA-p-SS-p-dA.
1-Thio-dATP is shipped as the mixture of two stereomers. One of these is a substrate for Klenow or Klenow exo-. Please contact us if you have any other questions.
We ordered a set of CleanAmp primers, and received them resuspended in 100% DMSO. Most typically, we resuspend our primers in TE Buffer, and dilute with water to a 25uM working stock, and a final concentration of 1uM in the PCR reaction. Will resuspension in DMSO be a problem?
Thanks for your question. CleanAmp™ Primers are supplied in DMSO to increase the stability of the CleanAmp™ modification. We suggest storing the primers in the DMSO stock solution and diluting only as needed. You can make a stock solution of the primer quantity needed by diluting the primers with water or TE buffer to a working concentration of 25 uM.
We recommend that CleanAmp™ primers be used in PCR at a concentration from 0.1-0.5 uM but we have found the primers can be used at concentrations up to 2 uM without seeing an effect from the DMSO. For further information you can review the CleanAmp™ Primer Product Manual. Please let me know if you have any other questions.
I am hoping that you can synthesize an mRNA for me. What is the limit of length for your service? My ORF (from start to stop) is 3845 nucleotides long. I have in an IVT vector but have not been able to get full length product.
Thank you for your interest in TriLink’s RNA transcription services. The T7 RNA polymerase used in our transcription is a fairly processive enzyme that allows for the successful synthesis of mRNA in the range of 4,000 bases. Final yield per milliliter of transcription tends to be lower for long sequences. And the ability to obtain full length product depends on the presence of transcription stop sequences within your transcript, i.e. strong hairpins. If you would like to further discuss your mRNA, please submit an online quote request.
Thank you for your inquiry. When stored and handled properly, stability of standard dNTPs and CleanAmp™ dNTPs is comparable. In both cases, it is the triphosphate chain that is most susceptible to degradation. When lyophilized (or dried) appropriately, both are very stable. In solution, CleanAmp™ dNTPs are as stable as standard dNTPs provided they are stored in relatively basic conditions, at least pH 8 to protect the CleanAmp™ modification from deprotection.
Does BHQ-1 require a linker for internal labeling of an oligo? How about 6-FAM? Do you have any information on how far from an end an internal label should be so that it doesn’t interfere with ligation?
Thank you for interest in TriLink. Black Hole Quencher 1 and 6-FAM can be placed internally in an oligo either with conjugation to an amine modified base, thymidine residues or by an internal amidite.
For ligation, the modifications should be positioned outside of the footprint of the ligase on the nicked DNA duplex. Although this does not appear to have been determined for typically used DNA ligases such as T4, it has been determined for Chlorella Virus DNA ligase and EcoLigA. For Chlorella Virus DNA Ligase, this footprint extends from 89 nucleotides on the 3′-OH side of the nick to 1,112 nucleotides on the 5′-phosphate side of the nick (Odell & Shuman). For EcoLigA, the footprint covers 19 nucleotides and is centered around the nick in the DNA duplex (Nandakumar et al). With this information in mind, the fluor and quencher should be placed no closer than 20 nucleotides from one another.
You can request a quote to discuss the constructs of the FAM and Black Hole Quencher with our Product Management team. We look forward to working with you on this project.
Hi, I just in-vitro transcribed a tRNA with GTPaS instead of normal GTP. I am going to take absorbence at 260 nm but I am not sure how to calculate the extinction coefficient of the RNA with modified non-bridged S. Could you let me know how should I get the correct extinction coefficient?
Hello Tien-Hao,
The alpha thiol modifications do not affect the extinction coefficient. You can use the same calculations you use for standard RNA. The article An Introduction to Extinction Coefficients and Molecular Weights of Oligonucleotides may be helpful. It can be found here: http://www.trilinkbiotech.com/tech/extinction_intro.asp
Kind Regards,
The TriLink Team
Are there any special conditions required for incorporating 4’Uridine-5’triphosphate into a short RNA sequence (I will be using T7 RNA polymerase with a template sequence of about 30 bases preceded by the T7 promoter sequence)?
Thank you.
Thank you for your interest in our modified NTPs. We currently do not offer 4’-modified uridine analogs as a catalog item but offer a 4-Thiouridine-5’-Triphosphate. I was able to find research which used 4-Thio-UTP in transcription reactions.
After reviewing recent literature, Sokoloski et. al. incorporated 4-Thiouridine following the protocol published by McGraw et. al. who used Milligan transcription (1:1 ratio of 4-Thio-UTP and UTP).
If you are interested in a custom synthesis of 4-modified-UTP, please submit your request online. Please let me know if you have any other questions.
Hi,
Im interested in your biotin-dNTP products. What is the difference (especially in enzymatic incorporation and/or after incorporation as a template for PCR) between Biotin-16-Aminoallyl-2′-dCTP (N-5002) and N4-Biotin-OBEA-2′-deoxycytidine-5′-Triphosphate (N-5004)? I want to incorporate biotin in a primer extension reaction (Klenow), pull down with streptavidin, and then use the biotinylated template for PCR.
Thanks!
Dear Jen,
Thank you for your interest in our Biotin labeled dNTPs. We have documented Biotin-AA-dCTP (N-5002) incorporating at a very high percent substitution for dCTP, up to 97%, in our white paper: PCR incorporation of modified dNTPs: the substrate properties of biotinylated dNTPs. We do not have analagous PCR data on the efficiency of the N4-Biotin-OBEA-dCTP (N-5004), but since the modification is to the N4 nitrogen, it may interfere with Watson-Crick base pairing. Therefore, while this dCTP analog can be incorporated in PCR, the percent substitution for dCTP may not be as high as for Biotin-AA-dCTP.
As you eluded to, different analogs will incorporate in PCR with varying efficiency and some optimization may be needed. We recommend performing some initial PCR experiments using natural:modified dNTPs in ratios such as 1:0, 3:1, 1:1, 1:3 and 0:1 to identify the best conditions for modified nucleotide incorporation with robust amplicon yield.
Kind Regards,
Angela
I need a biotechnologist to answer a few questions via email for my sons 6th grade project. If anyone can help us out please email me Nichole4cm75@yahoo.com…the interview must be completed by Thursday 3/15/12..Thank you in advance for helping my son ..
Hi,
1. Do you synthesize p33 DNA oligo? 2.What kind of phophorimager is used to detect tridium labled DNA oligo in acrilamide gel? 3. which one more expensive? S35 or H3 DNA oligo?
Thank you for your question. We have many years experience in preparing radioactively labeled oligonucleotides. However, we have decided not to carry P33 labeling and focus on isotopic sulfur (35S) and tritium (3H) oligo labeling.
We do not detect tritium labels by gel. Our standard radioactive labeling process includes purification by our double HPLC method, PAGE analysis (of the DNA sequence) and isotopic purity as determined by HPLC. We do not use photoimagers. However, this link may be helpful: http://imagers.salk.edu/pimager/pimFAQ.html It contains a section on Westerns, which describes a special screen to use for tritium detection. Tritium is low energy so you cannot do direct autoradiography.
Pricing is dependent on your construct (backbone, modifications, length) and the final quantity and specific activity you require. We would be happy to discuss your project with you. Please submit a quote request to facilitate further discussion. We look forward to working with you.
The speed at which your Speed Vac system dries down RNA is more a function of the efficiency of your Speed Vac than it is the RNA. The volume you are trying to dry down coupled with the quality of your Speed Vac system are the most critical aspects of the rate of drying. Speed Vac systems are excellent, but do require considerable maintenance to keep a strong vacuum. We like to see our systems pump down to less than 100 mTorr before they are considered adequate for many of our processes.
In order to maintain a strong vacuum, the pump oil must be kept clean and void of solvents. We change our pump oil at least weekly. All of the vacuum lines must fit tightly and be crack-free. The ice trap should be emptied routinely, since an accumulation of water in the trap will lead to a decrease in the vacuum. The lid of the centrifuge itself must be kept clean. We wipe the seals before each run with ethanol to ensure cleanliness and the maximum seal.
You can also reduce the volume in each individual tube. Aliquot your sample into multiple tubes prior to dry down.
One last suggestion is to go ahead and use the heating function of the Speed Vac centrifuge if yours is so equipped. Just be careful not to let the sample stay in the Speed Vac for any considerable length of time after complete dry down. Try to remove the sample as soon as it is completely dry. Until then the sample is kept cold by the cooling effect of the evaporation of the water.
I hope this helps. If you have any more questions about this, please write or call us.
I am looking for an adenosine based modified nucleoside triphosphate that has an amine group that can be used to link an RNA oligo after it is incorporated.
Thank you for your inquiry. While the compound you describe is not a part of our stocked modified nucleotides, if you have a construct in mind, we can prepare the material as a custom chemistry order. If you are interested, please complete a Custom Chemistry Quote Request and our Product Management team will get back to you shortly.
Thank you for your question. The product you requested can be reviewed for a custom job if you’d like to complete a Custom Chemistry Quote Request. In addition, new products are added to our catalog based on customer interest and application. If you’d like to contact us with more details about this compound we can add it to our new ideas.
Hello,
If you would have a 18 mer oligonucleotide but without the bases so only the phosphodiester backbone is present, would you recommend to purify it as you would do normally with the ones having the bases?
Thank you for your question. The three types of purification routinely used rely on different properties of the oligonucleotide to separate the final product from short fragments and impurities. Depending on what you replaced the bases of your oligonucleotide with, the properties of may be maintained.
If using dSpacer for the entire sequence, all our purification methods are an option.The purification method can be determined based on your desired purity and final application. For more information, see the When is my Oligonucleotide Pure Enough? technical article.
However, if you are interested in the abasic modification, we typically ship abasic modified oligos desalted and in solution as drying down the oligo results in cleavage at abasic sites.
Dear Natasha,
Follwoing Jia’s question regarding label DNA intercalating dye to nucleotide, I wonder what dyes Trilink use to provide this service. Can you label most of the SYTO family dyes (blue, organe, red and green) as well as the monomeric and dimeric dyes of PO, BO, TO, JO YO?
Thanks!
AC
Thank you for your inquiry. TriLink has the ability to incorporate any commercially available dye into an oligo as long as it is available as an amidite or NHS ester. Esters can be conjugated to our internal C6 amino modified bases, while amidites can be incorporated directly into the oligo. Since each synthesis is unique, each request must be reviewed and quoted on a case by case basis to ensure synthesis compatibility and quote accuracy.
Unfortunately we are not familiar with the monomeric and dimeric dyes that you mentioned in your inquiry, and it appears that the SYTO family is made up of stains rather than dyes used during oligo synthesis. We are typically willing to work with or analyze dyes not offered in our catalog, as long as they are commercially available. If you have any questions about a specific dye’s usage do not hesitate to contact us by email at sales@trilinkbiotech.com.
Yes, we are able to label DNA intercalating dye (e.g. Thiazole Orange) to nucleotides. Using TriLink’s custom synthesis service, we can conjugate your dye of choice to dNTPs containing the appropriate linker. Typically conjugations are performed to dCTP or dUTP nucleotides which contain linkers such as aminoallyl (CAT#s N-2048 and N-2049, respectively). To learn more about this service, please visit: http://www.trilinkbiotech.com/products/chemistry/polyphosphates.asp
I was wondering whether you have any idea about the resistance of an 80 bp long RNA strand containing 5-aminoallyl-2′-cytidine modifications to heating? I elute the modified RNA fragment from a denaturing PAGE gel and concentrate the eluted sample down from 1.2 ml to 100 micoliters on a speedvac. As this is very time consuming, I was wondering till what temperature I could heat the modified RNA during this process.
Thank you very much in advance,
Yours sincerely,
Marleen
The aminoallyl moeity should not affect the stability of the RNA to heating. The main point for breakdown of the RNA is the phosphodiester backbone, which is prone to degradation in the presence of divalent metals, basic pH, and heat. We recommend heating to the same temperatures used for unmodified RNA. We suggest an ethanol precipitation to concentrate your RNA, followed by a 70% ethanol wash. We assume there is EDTA present from the PAGE gel, which should help protect the RNA. Keep in mind that when you concentrate the RNA you are also concentrating any salts that are present. We always keep the supernatants until we are sure we have a good recovery. If recovery is poor, you can respin the supernatants. We hope your project goes well and feel free to contact us anytime.
Hi,
I am trying to extract 2’Omethyl modified oligos from serum/plasma. Some of my oligos may behave more like DNA, because they are fully 2’Omethyl modified. What would be the best way of extraction from serum/plasma???
Thank you for your help!!!
Thank you for your inquiry. We would suggest starting with a phenol/chloroform extraction followed by an isopropanol precipitation and a 70% ethanol wash. Although we are not aware of any 2′-OMe oligonucleotide pharmacokinetic publications that would have information along the lines requested. There are many publications by Isis and collaborators on 2′-MOE oligonucleotides, which are analogous, albeit with some phosphorothioates and only partial 2′-MOE modification. The methods used and cited their publication Phase I trial of ISIS 104838, a 2′-methoxyethyl modified antisense oligonucleotide targeting tumor necrosis factor-alpha could also be consulted for your purposes. Please feel free to send any follow-up questions you may have.
Hi,
I want to synthesize a modified mRNA using a invitro transcription system. I use 5-methylcytidine triphosphate(Trilink N1019) and pseudouridine triphosphate(Trilink N1014) instead of CTP and UTP respectively to make this particular mRNA (use ATP, GTP, 5mCTP and ψTP as the substrate).
The yield is very low (only 2ug products in 20uL reaction). However, the yield of control group (use ATP, GTP, CTP and UTP as the NTPs as the substrate) is very high (up to 50ug of mRNA products in 20uL reaction).
Could you help me why the invitro transcription yield dropped dramatically when i replace CTP ＆UTP instead of 5mCTP ＆ψTP?
We typically do not see a significant decrease in the yield when we substitute pseudo U and 5 methyl C for WT NTPs. Have the vials of pseudo U and 5 methyl C undergone many freeze thaw cycles? We recommend aliquoting the modified NTPs at the first thaw to avoid repeated freeze thaw cycles. It is also possible that the one of the modified NTPs has become contaminated with RNases. If this is the case, addition of the modified NTP to a reaction containing all four unmodified NTPs might show decreased yield. Please give me a call for any additional discussions.
Thank you for your inquiry. Yes, the molecular weight of a duplex can be determined by adding the molecular weights of the individual strands.
The characteristic that is not additive for a duplex is the extinction coefficient which can be 15-25% lower than the combined extinction coefficients due to the hyperchromicity of the duplex. The adjusted extinction coefficient can be found using the following formula:
(measured ODs/Total ODs of single strands) x Total Extinction Coefficient = Duplex Extinction Coefficent
Hi:
My name is Francisco Hernandez- Torres. Recently I have joined, as a postdoc, to Diego Francos’s Lab in the University of Jaen (Spain). Curently, we are interested in the study of some microRNAs biogenesis. The question is, coud it be posible to sinthesize a RNA oligo of 60-90 nucleotides long? In adition, coud it be posible to label some inner selected nucleotides as we desire?
Thank you
Thank you for your interest in TriLink. Yes, we can synthesize a 60-90mer RNA oligonucleotide. We have successfully made up to a 110mer unmodified RNA oligonucleotide and continue to try longer sequences as our customer’s request them. Yes, internal modifications can be incorporated. Click here for a full list of our oligonucleotide modifications. If you do not see what you are looking for, please let us know. Typically if a modification is commercially available, we can incorporate it for you. To request a quote click here, to build your oligonucleotide go to OligoBuilder®. We look forward to working with you.
Thank you for your interest in TriLink. 1-Thio-2′-Deoxyadenosine-5′-Triphosphate (N-8001) and 1-Thio-2′-Deoxycytidine-5′-Triphosphate (N-8002) can be incorporated by Taq in PCR. However, not all analogs will incorporate with the same efficiency in PCR; some optimization may be needed. We recommend performing some initial PCR experiments using natural:modified dNTPs in ratios such as 1:0, 3:1, 1:1, 1:3 and 0:1 to identify the best conditions for modified nucleotide incorporation with robust amplicon yield.
Hi,
I need a DNA oligo with a fluorescent dye attached for an fluorescence polarization assay. The linker between DNA and dye should be as rigid as possible and the dye most likely a BODIPYdye, dansyl or fluorescein dye. Attachement either internal or at the 5′ of the oligo.
What solution do you have for that?
Thank you for your interest in TriLink BioTechnologies. A shorter linker will provide the most rigidity between an oligo and a dye. Our shortest linker is the dT-C2 amino linker. The linker arm is attached to the Thymidine base and the dye would be conjugated onto the amino group post-synthetically.
Another option would be to use our C7 internal amino linker. This linker provides a short 4 carbon chain extending from the backbone of the oligo. This linker can be incorporated between nucleotides and will not add another base to your oligo, unlike the dT-C2 amino linker. As far as the dye is concerned, FAM typically couples better than the BODIPY or Dansyl dyes and will most likely provide a better quality final product.
We do not know how the length of the linker will affect your specific application. The shorter linkers will provide a more rigid incorporation of the dye, but these may not be an option if you need the dye further from the oligo than these linkers can allow. Please let us know if you have any further questions or would like to explore any other options. Thank you.
Hi – I just wondered if it is possible to buy NTP’s (in particular ATP) that works like the CleanAMP nucleotides. A preferable version would be activated by light, but is probably impossible to get! Any opinion on this would be appreciated very much!
Thank you for your inquiry. The CleanAmp™ modification can be introduced onto a number of NTP analogs, including ATP. This would allow you to control activation via pH or heat. There are other approaches to introduce light activatable modifications onto ATP as well. TriLink specializes in unique nucleic acid modifications and we look forward to learning more about how we can support your research. Please contact us to request a quote and discuss your project further.
Hi,
I left deprotected sulfhydyl modified oligomers on dry ice overnight, but found the ice had evaporated overnight. I don’t know how long they sat at RT before I got to them. Are they ruined? How fast is dimerization reaction?
Thank you for your inquiry. We do not believe your thiol oligomer was ‘ruined’ by this exposure. Your next steps depend upon whether your oligonucleotide was in solution or lyophilized. If it was lyophilized, a simple reduction step will eliminate any dimers. Here is the protocol:
1. Make a solution of 60 mM TCEP. (18 mgs TCEP in 1 mL H2O) 2. Add 125 uL 0.1M NaHPO4, 0.15M NaCl, pH 7.26, vortex & make certain oligo is in solution.
3. Add 75 uL 60 mM TCEP to oligo solution.
4. Vortex.
5. Let sit for 2 hrs at room temperature.
6. Run size exclusion column, RP-HPLC
If your oligonucleotide was in solution, we recommend doing a small test reaction to ensure the material is still functional. Please feel free to submit any additional questions by writing a comment below or emailing us at support@trilinkbiotech.com.
Thank you for your question. Prior to resuspending your oligo be sure to centrifuge it briefly to ensure all product is down in the bottom of the tube. We recommend bringing your oligo up in any aqueous solution with a neutral pH. If you use just water, be sure that it is nuclease free. We also suggest aliquotting your oligo into one-time usage amounts to avoid multiple freeze-thaw sessions. If you have any further questions please do not hesitate to contact us.
Thank you for your interest in TriLink. CleanAmp™ dNTPs have a t 1/2 of 40 minutes at 95°C. We are currently developing new, improved version of CleanAmp™ dNTPs that have a t 1/2 of 7 minutes. We are also working towards an isothermal solution, but have found some inherent challenges in finding the right balance of product stability and activation of the leaving group. We may have a chemistry that would work for your application or our custom chemistry team could synthesize a unique chemistry for you. Please contact Shawna Leaver, our Custom Chemistry Product Manager, through info@trilinkbiotech.com or 1-800-863-6801. You can also submit your quote online by clicking here.
Thank you for your question. We recommend resuspending oligonucleotides in aqueous, neutral solution. It would be best to resuspend your trimer oligonucleotide in DDI water. If you have any further questions, please do not hesitate to contact us.
Do you have any CleanAmp products that were determined to be product “failures” during your development? I know you made products with a hot start at high temperature a goal but do you have any chemistries that activated at ~56oC and were never released as viable product? Customized chemistries are of interest for ongoing development in my organization with an activation temp ~56oC.
Thanks, Dan Shaffer
Thank you for your interest in our CleanAmp™ Products. We did, as you thought, try several protecting groups before landing on the current CleanAmp™ chemistry. We are also working towards an isothermal solution, but have found some inherent challenges in finding the right balance of product stability and activation of the leaving group. We may have a chemistry that would work for your application or our custom chemistry team could synthesize a unique chemistry for you. Please contact Shawna Leaver, our Custom Chemistry Product Manager, through info@trilinkbiotech.com or 1-800-863-6801. You can also submit your quote online by clicking here.
Hello,
Is there any product or derivative of alpha nucleotides/nucleosides available in the market
Hello,
Do you have experimental or simulated secondary structures for your stocked mRNAs? Do you expect that the stocked mRNA would be folded or unfolded in your storage solution?
What is the molecular weight of CleanCap Cre mRNA (5moU)?
Hello,
I would like to load CleanCap EGFP mRNA into biological vesicles. Is that possible to remove (degrade) from the solution the unloaded CleanCap EGFP mRNA with RNAse?
Best regards,
What are the advantages of 5-methoxyuridine modifications? Are mRNA 5-methoxyuridine modified mRNAs more stable to RNAse degradation? Both in vivo and in vitro?
thank you!
Angeles
We want to use the CleanTag Small RNA library prep kit to sequence miRNA from plasma/serum but extract miRNA with automated extractor that elutes in 50ul final volume. So since the recovery amount is very low and also very dilute, is it possible to concentrate with vacuum or precipitate the RNA before proceeding? since the maximum initial volume is 2-10ul.
Do you have any other advice on this?
Hi!
How do you determine your mRNA concentration and which extinction coefficient do you use?
I am wondering if we need to include the sodium counterion in our molecular weight calculations of the mRNA or not and this depends on how you calculated the 1.0mg/mL concentration of some stocked mRNAs, because it influences, how many mRNA molecules or in that tube of that weight concentration.
Can you help me here?
Hello,
I am interested in ordering CleanCap® FLuc mRNA (5moU) – (L-7202). What is the shelf life for the 5moU mRNA (at <-40oC, no F/T)? Do you ship it as powder or solution?
Thank you in advance.
Best regards,
Lena
Hi! I am wondering if the mRNA is stable and still active if it go through 40-50 degree high temperature for a few minutes?
Hello Trilink,
Can Trilink offer the synthesis of an RNA oligo with a Trimethylated Cap (m3(2,2,7)G; like the one found on most mature snRNAs)?
Best regards,
Søren
Is your “2′-Deoxynucleoside Alpha-Thiol Nucleotide Set – (K-1001)” available for reverse transcription using RNA templates? And, if available, how long can you extend cDNAs by? I’d like to perform RT reaction of 200~400 nt.
Dear,
I cannot seem to find the method that is used for the purification of mRNA, could you give me this information? Is there a difference in methods if you order custom made mRNA compared to catalog mRNA’s?
Best regards,
Sigrid
Hi,
I want to order 5′-5′ inverted base(internal) modified DNA oligo. I know that 3′ end of inverted base modification blocks the PCR. Does the internal 5′-5′ inverted base in the template strand also block the PCR?
Best,
HS
Hi,
We bought some pseudo-UTP from TriLink and would like to add it during IVT. But I realized as we are using linearized plasmid as template, and the plasmid sequence just was cut a ~100 bp off to make it linear, which means it has extra sequence that do not contribute to mRNA synthesis. Will it affect the amount we need to use for pseudo-UTP modification? Or it better to use the linearized plasmid that only contains mRNA sequence?
Thanks for your help in advance!
Hello Trilink,
I will need to dilute Cre mRNA, provided by Trilink, for my electroporation experiments of mESC. What would you recommend using for the dilution? What handling procedures would you suggest while creating the dilutions?
Thanks,
Katharina
I am interested in making an RNA that does not possess a 5′ phosphate or cap structure (a simple 5′ hydroxyl is preferred). Can RNA be transcribed in vitro using T7 RNA polymerase and ApG dinucleotide as the initiator and the appropriate variant T7 promoter, analogous to using the CleanCap reagent, in order to generate RNAs that lack a 5′ phosphate? Will T7 accept the ApG dinucleotide for initiation from variant T7 promoters, and will this dinucleotide inhibit extension in any way in the process of transcribing the full length RNA. Many thanks, Andrew.
My wife is anaphylaxis to the flu shot
Is the covid19 vacinations safe
2 doctors 1 a neurologist say no
What is known about this problem
I am needing an MSDS sheet for “coldset black ink” for printing newspapers. Is this available?
Hello,
Our lab has been using CleanCap Cas9 mRNA – (L-7606) for gene editing in primary epithelial cells, but the gene editing has been very low (despite confirming that the transfection efficiency is not the issue). I was wondering if the CleanCap Cas9 mRNA (L-7606) has the following three particular modifications (which are said to decrease the immunostimulatory response and increase gene editing efficiency):
– Cap 1
– 100% Substituted/uridin-modified
– Purified to minimize double stranded RNA
Thank you
Hellow
The length of the Poly-A tail will determine the RNA degradation rate.
What’s the polyadenylation length TriLink adds and can it be shortened or lengthened on demand
Hi,
Regarding your CleanCap® OVA mRNA (5moU) – (L-7210) product, I was wondering if you tested if it is stable/functional after 1 freeze-thaw cycle? Or would you recommend to avoid the freeze-thaw at all?
Thanks!
Hello
I want to order CleanCap EGFP mRNA.
What is the difference between mRNA with 5-methoxyuridine or without and how it will affect mRNA expression?
Hello Aviad,
Thank you for your question. Essentially, the 5-Methoxy-U (5moU) version (L-7201) has a full substitution 5MoU in place of Wildtype-U. 5MoU substitution has been shown to decrease innate immune response and increase translation efficiency. Please contact us at sales@trilinkbiotech.com with any additional questions.
Best,
Taylor
Hello, can I order triphosphorylation of modified nucleoside prepared in our lab.?
Hi Keiichiro,
Thank you for the inquiry and your interest in TriLink. Yes, TriLink does indeed offer manufacturing services to convert a client’s novel nucleoside into a nucleoside triphosphate. Please email the information requested below to sales@trilinkbiotech.com and we would be happy to further discuss your custom quotation.
1) Exact structure of the starting material
2) Desired starting scale (mg of nucleoside) or target final yield (umole of NTP)
3) Purity requirements, if known
4) Desired final salt form, if known
Best Regards,
Scott
Hello,
I see that your company is able to synthesize a variety of oligonucleotides and is available for GMP and clinical studies. I was looking to find if you provide radiolabelled oligonucleotides but didn’t find any information. Do you not provide this service, and if not, do you have a recommendation for performing PK or other preclinical studies on non-radiolabelled nucleotides?
We are trying with difficulty to transcribe full 11kb RNAs from a DNA template using T7 and then we hope to perform double-strand cDNA synthesis on full-length transcripts in the resulting samples. Do you have some recommendations to assist with these steps? We do not want fragmented RNA.
Hello,
We are looking to source RNA that is sufficient quality for NMR study.
We’re following a protocol described in a paper, and it states “RNA was resuspended in water and precipitated with butanol to remove traces of small molecules resulting from the chemical synthesis.”.
Which purification methods would be most appropriate for this application?
Hello!
I was inquiring about the possible purchase of a Smad4 selective aptamer for the purposes of extraction and quantification.
Will 2’F NTPs be digested by RNase H when duplexed to an unmodified dNTP complement? On one page for an 2’F modified nucelotide, it is stated that RNase H will not process FRNA when duplexed with RNA. Im curious about RNase H processing when FRNA is duplex to DNA. Thank you
Jon
Dear TriLink,
I would like to acknowledge the receipt of 2-Aminoadenosine-5′-triphosphate in Lyophilized form. I would like to know how to prepare 100mM solution means just I have to add 50uL nuclease-free water?
Does Product A-9202 work with larger than 60 nucleotides molecules for the S-4FB molecules? The parameters say the yield would be lowered. I intended to use a 360 nucleotide molecules but fear the conjugate yield may be non existent.
Hi,
We’re interested in in-vivo (i.m/i.d.) delivery of mRNA.
We want to initially evaluate the delivery efficiency, and are thus interested in a control luciferase-encoding mRNA, to be monitored via IVIS.
Do you carry such ready-to-use mRNAs, or do I have to provide you with the relevant sequence to be synthesized?
Thank you in advance,
Uri
Hi,
Do you have ARCA capped eGFP mRNA?
I am going to order an custom mRNA.
I will send my PCR product to TriLink and you guys will perform IVT.
My question is that what is the minimum amount of mRNA that I can order?
Sincerely,
Shin-Il Kim
Hello,
Do you offer custom small scale cognate and amber tRNAs? Possibly charged with unnatural amino acids? The tag is specific and could be provided by us.
Thank you,
Ivana
Was wondering if you had a recommended ratio of rGTP to CleancapAG in capping reactions for in vitro transcription. Can CleancapAG be used with SP6 or T3 polymerase driven IVT reactions.
Hi,
If I want to introduce the modified NTP (such as pseudo-UTP, or 5moC) into my mRNA during IVT, should I replace all of the normal NTP with modified NTP for IVT? THX
We recently purchased CleanCap™ EGFP mRNA (L-7601-100) as controls for mRNA delivery experiments. I have transfected U87MG cells using lipofectamine 3000, and 2.5ug of mRNA transfect per small dishes. Control transfections using this cell line produce significant GFP and imaged by confocal microscope. We also want to do time-dependent GFP expression experiment. Can you tell us what is the minimum time need to express this mRNA transfection?
Dear Sir or Madam,
I am trying to generated IVT mRNA using 4-thio UTP within the reaction mixture but I have been unsuccessful in gernerating RNA using Thermo MEGAscript IVT kit.
Is 4-thio UTP able to be incorporated by T7 polymerase?
I am looking for adenosine tetra phosphate (ppApp) and/or adenosine pentaphosphate (pppApp) as a standard for HPLC analysis, I need very little. Do you have these or can you synthesize them?
Can CleanAmp primers be activated at temperatures lower than 94C?
Any suggestions on in vitro transcribing long RNA (>10kb)? what enzyme to use and conditions?
Can I submit multiple oligo sequences containing modified nucleotides for a single quote through OligoBuilder?
Hello Trilink,
Is it possible for CleanCap AG to degrade due to multiple freeze-thaw cycles? If so, how many freeze-thaw cycles can CleanCap AG undergo? Would RNA yield be effected if degraded?
Thanks,
Marcos
Splicing changing oligos do work well in cell culture, but not in rat spinal cord
Dear Customer support,
we generated splicing changing oligos that work well in cell culture and mouse brain (18 mers, 2′-O-methyl-monophosphothioates) from you. However, they do not show efficacy in rat spinal cord. I went though the trouble to generate the rat reporter genes (rat DNA) and the oligos show efficacy in cell culture, but again not in rat spinal cord. The oligos are taken up, but no splicing change.
Is there another chemistry that you could recommend?
Have you heard of similar problems (I could not find anything in the literature), as these negative results usually don’t get reported.
Finally, we used to order all our RNA oligos from TRILINK, usually 2 weeks turn around. In the last two months, this went up to 2 months, which is not acceptable. Has this problem been solved?
thanks
stefan
Dear Dr.,
I want aptamer sequence for ssDNA that used as random.
Regards
Afrodet
Hi!
What is the guaranteed yield on a umoles order? I ask because at IDT the guaranteed yield is far lower than the yield order, and its dependent on the purification method used among other things.
Hello,
Which PCR polymerases are compatible with 5-Indolyl-AA-dUTP (N-2065) ?
Thank you.
How effective is this in high performance athletic ability.
Did increase strength and conditioning level ? Is it similar to ATP, ?
Hi,
I just wanted to know if without cloning we can directly sequence the selected aptamers to avoid loosing any important aptamer. Which sequencing platform should be used? What are the pros and cons of not cloning them?
Thanks,
Sanskruti
Hi,
I’m interested in trying your CleanCap reagent instead of ARCA. You state that an AG initiator is required for the CleanCap Reagent AG. Is this referring to for instance the “AG” where transcription is initiated in the T7 promoter sequence TAATACGACTCACTATAG, or something else?
Kind regards
Hi,
I´m interested in synthesizing a couple of miRNAs but I´m not sure which primary backbone or purification to use.
Thank you
Hi, I wonder if you already have an aptamer for detection of E.coli. Could not find it on your WEB.
Hi,
I need a DNA SELEX library of 40 random nucleotide and 17mer primer sites (around 100nmoles) with 3′ biotinylated primer and 5′ unmodified primer. I would like to know how much does it cost to ship to South Korea and how much does it cost.
Hello,
I would like to know what is the max lenght of a DNA oligo conjugated with biotin you could synthetize.
Hi! I noticed my modified single strande RNA oligos (lyophilized powder) are always shipped at room temperature, sometimes it is an over the weekend shipment. I am wondering if this will affect the stability of my RNA oligos? What is the average storage time for RNA oligos powder at room temperature?
Thank you!
Ying
Hi,
What are the minimum requirements for shipping mRNA over a 24-48h period? Is there a minimum volume that it should be shipped at e.g. not less than 100 ul? Could a lower volume mean the mRNA is more susceptible to degradation?
Are there certain buffers that you always recommend?
Is there an easy assay that could be carried out each time the mRNA is used to determine whether any loss in quality has occurred?
Many thanks
Dear Heather,
Thank you for the inquiry. We routinely prepare aliquots of our mRNA in sizes as small as 20 uL @ 1 mg/mL, although we do not recommend aliquot sizes any smaller than 20 uL. We also ship all of our mRNA products in an insulated box on dry ice, and recommend storage at -40°C or below.
We formulate all of our catalog mRNAs in 1 mM Sodium Citrate, pH 6.4. We have found that this buffer provides both high solubility and stability of the mRNA when stored and handled properly. If you have identified a different buffer that you prefer, we can likely formulate the mRNA in that buffer for you as an alternative. We do recommend that single-use aliquots be prepared in order to minimize freeze-thaw cycles, which can cause degradation. To analyze the mRNA prior to use, we recommend confirming the length of the mRNA on a gel and/or bioanalyzer. If you have any additional questions or need further assistance please contact sales@trilinkbiotech.com.
Best Regards,
Scott
Hello
Do 6-Thio-2′-deoxyadenosine-5′-Triphosphate exist in the word? Why I can’t find it in any web?
Thank you for the inquiry. We can definitely assist you in creating a custom synthesis of this compound. Please contact our Technical Support team at sales@trilinkbiotech.com if you would like to discuss 6-Thio-2′-deoxyadenosine-5′-Triphosphate. We currently offer 6-thio-2′-deoxyguanosine-5′-triphosphate in our ready-made stocked catalog, but we do not have the adenosine analog stocked. Also, we are not familiar with an alternative commercial source for this material.
Best Regards,
Scott
Hello, I would like to ask you if it is possible to use CleanTag Small RNA library prep kit also for piRNA sequencing or if the adapters bind only to miRNAs. Thanks a lot for your answer.
Best,
Petra
Hello Petra, CleanTag library preparation is a ligation based method that is designed to tag adapters onto small RNA species with a 3′ OH and 5′ P.
piRNA is thought to have this type of structure and would therefore be compatible with the CleanTag kit. If you have any additional questions or need further assistance please contact sales@trilinkbiotech.com.
Best Regards,
Joey
Hi,
I am referred to your company by Lina Borozdina at AIC. I want to synthesize a branched structure DNA molecule, and this molecule is able to be conjugated with enzymes (ex. Horseradish peroxidase).
Lina told me your company should be able to help us with that. Can you let me know how to start and to get a quote? Thanks.
Ning
Hi Dr. Chang,
Please send an email to sales@trilinkbiotech.com to discuss the specifics of your project.
Hello
I bought oligonucleotide labeled with Black hole quencher 2
But is there any information about BHQ2 related with thermal stability?
I want to know in what environment BHQ2 can work successfully.
I will wait for your reply
Thank you
Hi Lee,
Here’s a pdf link to a publication on qPCR using BHQ2 that gives the following thermal cycling conditions during which BHQ2 is apparently stable enough for qPCR. The caveat is that using a different buffer/pH can alter thermal stability of BHQ2.
https://www.researchgate.net/profile/Ilya_Aparin/publication/304528403_Cy5BHQ_dye-quencher_pairs_in_fluorogenic_qPCR_probes_Effects_of_charge_and_hydrophobicity/links/5804aedd08aefc585950ab64.pdf
Hope this answers your question let us know if you require any more information!
Does custom oligo synthesis extend to dinucleotides or trinucleotides? For example, if one wanted GpAp or pGpAp or AppGpAp, would any of those be possible to order?
Hello Professor Collins,
We are able synthesize dinucleotides and trinucleotides. Please contact sales@trilinkbiotech.com for information or to obtain a quotation.
Best Regards,
Joey
Dear Madam, dear Sir,
Could you provide the precise sequence of a T7 promoter that can be used to incorporate CleanCap AG?
What is the functional difference between CleanCap AG and 3’methyl Clean Cap AG? Is one performing better as far as translation is concerned?
Yours
Hi Steve,
Thank you for the inquiry. We recommend using the following sequence for the T7 promoter for use with CleanCap AG, with the highlighted bases being the first three bases of the transcript.
TAATACGACTCACTATAAGG
Please also see below for some data comparing the different cap structures, including CleanCap AG and CleanCap AG (3’OMe). Please feel free to contact us at sales@trilinkbiotech.com for more information.
How long can we store a Clean Cap labeled mRNA assuming no RNase contamination? We need to run experiments in the future but would like to have the stock readily available. Should we order now, aliquot (carefully), and store at -80C? If so, how long should the un-thawed aliquots retain functionality? Thank you.
Hi Tammy,
We have seen our mRNAs maintain stability for multiple years when stored at or below -40°C in Rnase-free conditions, although we do not report a formal expiration. We also recommend that you prepare single-use aliquots in order to minimize the number of freeze-thaw cycles, which should help maximize the integrity of the mRNA over time.
I’d like to know the excitation wavelength and emission wavelength of luciferase that your company used.
Hi Nancy,
We offer more than one form of Luciferase you can find the list of our mRNA’s here: https://www.trilinkbiotech.com/cart/scripts/prodList.asp?idCategory=194
Please contact sales@trilinkbiotech.com for more information on specific items.
Hello,
I’ve just had some very encouraging results using your Cy5-mRNA for eGFP. Are you able to tell me what version of eGFP this is and do you know the protein half life?
Thank you
Hi Edd,
Glad to hear about your success! Please contact sales@trilinkbiotech.com and we can provide you additional details regarding the eGFP mRNA sequence.
We are working on mRNA delivery, and now we are trying to test the protein expression in the liver. We have some problems with the detection methods, specially in the WB. We are working with your Cas9 mRNA, but finally the protein detected has a lower weigh as expected. We would like to know the exact molecular weight of the codified protein.
This is the reference that we use: L-7206.
Could this protein be in a truncated form?
Hi Laura,
Please Contact sales@trilinkbiotech.com and we can provide additional details regarding this mRNA for your review.
what is A260 units ? and how to convert it into concentration?
for example : 12 A260 units of oligo
Hi Miko,
We have a detailed explanation how to convert A260 units into concentration which can be found here:
https://www.trilinkbiotech.com/tech/extinction_intro.asp
How is conjugated fluorescein (6-FAM SE) to nucleotide in internally labeled oligo RNA? On your webpage there is only shown in which way 6-FAM is linked to 5′ end of oligo.
Thank you in advance for your reply.
Hi Stefan,
The exact structure would depend on which amino-modified base was used. For example, if 5-aminoallylcytidine was used, the structure would be like to the one found at the link below, but just replace cyanine-3 with fluorescein.
Example
I hope this covers your question, if you require futher explanation feel free to email us directly at sales@trilinkbiotech.com
Do I need a license from Trilink to develop mRNA therapetuics
If you are developing a mRNA therapeutic that is based on a native sequence, wildtype nucleic acids with enzymatic capping, it is our understanding that you do not need to have a license. It should be noted that there are a number of modifications that are typically done to mRNAs to optimize their translation efficiency, stability and ease of transfection. Some of those technologies are covered by IP and would require the respective license. Also it should be noted that certain applications have IP concerns as well.
For all custom mRNA quotes we include the following note:
Please contact sales@trilinkbiotech.com if you require more information.
I would like to order RNA oligo for fluorescence polarization assay. Should I choose e.g. a 6-FAM as internal label or maybe it is better to choose nucleotide with linker which will be fluorescently labelled?
Thank you in advance for your reply.
Hi Anna,
In general, we recommend a more rigid attachment of the dye as extra rotational freedom and flexibility of the dye would generally reduce the effect of fluorescence polarization. The internal dye label in your oligo should lead to an increase in fluorescence polarization; however, this is dependent on your specific assay.
What kind of linker is between nucleotide and 6-FAM if I choose internal labelling of RNA?
Hello. I found that you provide modified nucleotides that I am interested in- 5mdC, 5hmdC, 4mdC, 5fdC, 5cadC, N6mdA (item#s N2025,26,57,60,63,64). Do you also offer deuterium-labeled versions of these nucleotides?
Hi Andy,
Sorry – We do not sell deuterium labeled nucleotides.
Do you have a recommended ratio of EGFP mRNA (L-6301) to Cas9 mRNA (L-6125) if they are transfected together? I imagine they have different expression efficiencies and would like to prioritize Cas9 expression but maintain a suitable level of GFP expression to gauge electroporation efficiency.
Hi Antanas,
Unfortunately we have not done this experiment before, but one of our senior scientists suggests that a 5:1 Cas/EGFP mRNA ratio might be a good starting point.
I would like to incorporate one 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) [N8004] at 3′ end of a double strand DNA blunt end with Klenow Exo- to obtain a T tail end with a phophorotioate bond. The expected final result :
–NNNNN*T-3′
–NNNNN-5′
Would it possible ? Do you think that the strategy is correct ?
Hi Charles,
The enzyme sounds correct and in general you should be able to end label your DNA however we’re not sure if it will work with a blunt ended DNA molecule.
You may have to create an overhang with your DNA and then add the Thio NTP as the enzyme is used to doing this to fill in a nick. It is possible you may get a low level of activity with a blunt ended DNA but we’re not sure.
-NNNNN -NNNNN*T
-NNNNNN-5’ -NNNNNN
I’d like to buy modified nucleotides to be used to replace common dNTPs in a PCR reaction. in particular I’d like to use une nucleotide modified with a quencher and another with a receiver to be used in a FRET reaction.
Can you make it? I have no ideas about the couples to be used as acceptor/donor
Thanks
Hi Yuri,
This is currently not an item that we offer in our catalog, but we could potentially manufacture it as a custom synthesis. You can request a quotation via email (sales@trilinkbiotech.com) or through our online quote request form (http://www.trilinkbiotech.com/oligo/quote.asp)
Do you have any product for CRISPR/Cas9? Especially CRISPR/Cas9 mRNA.
Hi Jian,
Yes we do offer Cas9 mRNA you can find it and related products here: http://www.trilinkbiotech.com/cart/scripts/prodList.asp?idCategory=196.
Is it possible to order CleanAmp Primers with 5`biotin modification?
Hi Andrio – We are able to synthesize CleanAmp Primers with a 5’ Biotin modification. Do to the addition of this modification, we do require RP-HPLC purification. Our Product Management team would be happy to provide a quotation for this synthesis. You can request a quotation via email (sales@trilinkbiotech.com) or through our online quote request form (http://www.trilinkbiotech.com/oligo/quote.asp). If you have any additional questions please do not hesitate to contact us.
On the CoA for Biotin dUTP, the methods of analysis for the ‘Manufacturing Lot’ are AX-HPLC, P NMR, H NMR, Mass Spec, and UV-Spec. What are the criteria for a ‘Pass’ for each analysis? The results simply state ‘Passes’.
Hi Stephen,
The specs are as follows:
AX-HPLC: ≥90%
P31 NMR: ≥90% @ 290 nm
H1 NMR: Supports Structure
Mass Spec: 947.8±5 amu
UV-Spec: Supports Structure
Do you also offer PNA?
Yes we do – Please contact sales@trilinkbiotech.com if you would like a quote
Do the CleanTag™ Small RNA Library adapters contain a UMI (Unique Molecular Identifier) sequence? Can they be ordered with a UMI sequence?
Hi Adelheid,
No the Adatpers do not contain a UMI. In the past, we have tried adding randomer regions to different parts of the adapters, with one of the purposes being to have them there as UMI’s however they failed to inhibit adapter dimer formation as much as the current CleanTag adapters.
Although we do not know the exact reason, we speculate that the current modifications to suppress adapter-adapter ligation are influenced by their sequence context. Thus, when we alter the sequence even slightly, we do not see as strong of an adapter dimer suppression like we do now.
Does TriLink offer any mRNA formulation options post IVT such as protamine sulfate or immune adjuvants?
Hi Jed,
We do not offer custom formulations. Our standard custom mRNA is provided in RNase-free 1 mM Sodium Citrate, pH 6.4 and is not concentrated. If you would like the final mRNA product provided in a special buffer or at a specific concentration, this can be accommodated at an additional cost. Please inform TriLink at the time of quotation.
Is it possible to order the CleanAmp primers with a label like cy3?
Dear Dr. Harder,
Yes, you can modify CleanAmp primers with a fluorophore such as Cyanine 3. You can request a custom quote by sending your sequences to sales@trilinkbiotech.com.
Kindest regards,
Danica
What is the longest RNA sequence that your company can chemically synthesize?
Are you able to incorporate nucleotides at site specific locations?
Can these specific nucleotides be deuterated, 13-C, and/or 15-N labeled?
For example, I would like a 300 nucleotide long RNA with nucleotide #100-110 completely deuterated and the rest of the nucleotides fully protonated.
We offer a couple options for RNA synthesis, depending on your construct.
1. Via our synthetic route, the maximum number of RNA bases is approximately 100-110 NT.
2. Via our transcription route, the minimum number of RNA bases is approximately 200 nt.
We are able to synthesize site specific 15N/13C isotope labeled oligos via our synthetic route, however we require that the customer supply the isotopic amidites. We recommend contacting Cambridge Isotopes for purchase of the amidites.
Via our transcription route, we can supply the necessary triphosphate, but site specific modifications are not possible.
If you would like a formal quote, please contact our Product Managers at sales@trilinkbiotech.com.
Dear all,
I have some Lyophilized aptamers. I need to know it is ok to resuspend them in water! Could you help me?
Thank you very much!
Federica
Dear Federica,
We recommend re-suspending oligonucleotides in aqueous, neutral solution. We typically store our Oligonucleotides in water for extended periods, however, buffer is also acceptable. The buffer you choose will depend on your application. We recommend a neutral pH buffer. Please let us know if you have any additional questions.
Best Regards,
Tiffany
in the article published by NAR (Cycling of the E. coli lagging strand polymerase is triggered exclusively by the availability of a new primer at the replication fork. ) the question is in what specifically the dGDPNP that designed for this study purpose what is the components of this neucleotide analogue
Dear Mayada,
Thank You for your question. Here are the components of the analogue.
2’-Deoxyguanosine-5’-[(β,λ)-Imido]Triphosphate.
Please contact us if you have any additional questions.
Best Regards,
Jessica
Hello,
Will the F. luciferase mRNA control (L-6307) work well with IVT kits such as the ThermoFisher 1-Step Coupled IVT reaction? We are thinking of using it as a control to probe for both S-35 Met incorporation and Luciferase activity.
Thanks
Dear Brian,
Thank you for your email. We have never used the ThermoFisher 1-Step Coupled IVT kit but believe that our mRNA should be a suitable control as described.
Please let me know if you have any additional questions.
Regards,
Brea
Hello,
We transfected eGFP transcripts (WT, 2-Thio-U, and alpha-thio-U) produced in October 2014. We cannot see GFP expression with none of the transcripts after 24h of transfection. Those transcripts were conserved at -80°C and thawed two times. The first time, we performed a non denaturating gel that revealed two major bands for each transcript (one was lower to the expected size and the other one was upper). A smear was detected from the loading well to the lower major band. Aliquots were performed for each transcript and one aliquot was thawed yesterday for transfection.
Could the pattern revealed by our non denaturating gel reflect RNA degradation and more than one year of storage at -80°C is it not long to preserve the complete integrity of our transcripts ?
I thank you very much in advance
Best regards,
Vincent
Dear Vincent,
Thank you for your email. I don’t believe this is a sign of degradation since the molecular weight of the smear runs higher than the major bands. If your mRNA is prepared well and does not contain Rnases, you should be able to keep it at -80 for at least a year and freeze-thaw it multiple times without degradation. It is likely that the smear is due to structural changes of the mRNA during the freeze-thaw process. I would suggest using a denaturing gel system. Transcript length and integrity are confirmed via agarose gel analysis after glyoxal treatment.
Please let me know if you have any additional questions.
Regards,
Brea
Hello,
We would like to use CleanAmp dNTPs in our PCR but were unsure if they will de-protect efficiently at 92°C since that’s the temperature we’ll doing denaturation initially and at every cycle.
Thank you, Chun-Nan
Dear Chun-Nan,
The CleanAmp(TM) dNTPs have a half life of 5 minutes at 95°C in PCR buffer. At 92°C the deprotection rate will be slightly slower however this temperature should allow deprotection of enough of the CleanAmp(TM) dNTPs to work in your PCR. If needed, you could extend the time of the initial denaturation. Please contact us if you have any additional questions.
Best Regards,
Sabrina
How do you dry your oligonucleotides? What equipment do you use?
Dear Lee Hye,
Thank you for your question. We lyophilize our oligonucleotides in a lyophilizer or speed vac. Please let us know if you have any additional questions.
Best regards,
Tiffany
I am using the TriLink CleanTag library prep kit. Could you kindly point me to the adapter sequence(s) that would need to be trimmed? Thanks!
Dear Jan,
Thank you for your email. The adapter sequences can be found on the CleanTag™ Ligation Kit for Small RNA Prep product page.
Please let me know if you need any additional information.
Regards,
Brea
I am planning on using an SELEX approach for isolating an aptamer perfect for my target viral protein. I am comfortable with most of the procedures except for the target protein immobilization step. Do you provide any magnetic beads or anything that we could use for immobilizing our target protein on?
Dear Teja,
Thank you for your inquiry. Our Product Management Team will reach out to your email address to discuss this further.
Best Regards,
Joey
I was wondering if you had data regarding the typical level of template DNA contamination in your final in vitro transcription-derived RNA preps? I need RNA for use as a standard in an assay so I really need to limit the amount of DNA in the prep.
Dear Bill,
Thank you for your inquiry. Our Product Management Team has reached out to your email address to discuss this further.
Best Regards,
Joey
Dear sir/madam :
I am planing to do selex round. If i have ssDNA 25 random nucleiotids flanking by to primer biding site so totally 66mers. My targets protein will be MLL1. So i am wondering what are the factors to be considered regarding binding ratio of initial ssDNA library with protein and subsequent rounds. what should be the recommended binding ratio for the first and the following selex round?
Dear Khun,
This is something you should determine experimentally for your protein of interest and your library.
Our biologists have provided a few publications which describes a RNA and DNA selection protocol which may have additional information.
In Vitro Selection of RNA Aptamers to a UNIT 24.3 Protein Target by Filter Immobilization
Design, Synthesis, and AmpliÞcation of UNIT 9.2 DNA Pools for In Vitro Selection
Best Regards,
Tiffany Teng
Product Specialist I
We recently purchased eGFP mRNAs (L-6101 and L-6402) as controls for mRNA delivery experiments. I have transfected HEK293 and DU145 cells using lipofectamine 3000 and PEI (5:1 weight ratio) and am unable to see GFP expression (by FACS) after 7 or 24 hours. By FACS (looking at cy5) the delivery looks good. I have tried both the labeled (L-6402) and unlabeled (L-6101) side by side and transfected 100 or 200 ng/well (96-well plate) into cells at about 50% confluency. Control transfections using these cell lines with a CMV-eGFP plasmid produce almost off-scale GFP expression when measured by FACS. Is there something wrong with my protocol and what is the timing and level of GFP expression I should expect in comparison to a plasmid transfection?
Dear Scott,
Thank you for your inquiry. I would suggest checking for mRNA degradation. Make sure you are using serum free reagents (ie Optimem) that are rigorously RNAse free. We use special pipets for mRNA and for example do not do minipreps or maxipreps with these pipets. RNasezap can be used to clean work surfaces and pipets. FACS signal from the Cy labeled RNA does not ensure that there was good delivery since the RNA could simply be trapped in an endosome. This experiment should work well in the 293 cells, we have no experience with the other cell line. Additionally, you make want to experiment with the timing. Though I would expect to see EGFP expression at your indicated time points, many factors influence expression and half-life. We and others typically see peak expression between 12-18 hours.
Regards,
Brea
What methods do you recommend for evaluating mRNA degradation?
What’s your guaranteed minimum yield (OD) for oligos ~60bp in length after HPLC purification on a 200nmol and a 1umol scale?
Dear Ben,
Thank you for your email. At the smaller scales, 15 umole and below, there is no guarantee of final yield. Each oligo has unique synthetic properties based on its sequence and modifications; therefore it is not easy to predict how much material will result from a particular synthesis.
Our general expectations for HPLC purified unmodified DNA oligonucleotides are as follows:
0.2 µmole scale 5 – 15 OD260 units (˜0.15 – 0.5 mg)
1.0 µmole scale 20 – 60 OD260 units (˜0.66 – 2 mg)
If you require a specific yield, please let us know when you place your order or request a quote.
Regards,
Danica
Hi
I want to conduct 3D PCR as desribed by Suspene et al. I have ordered DIT and dDTP from your company. Is 2-amino-2′-dATP the dDTP that Suspene is describing?
And is Pfu polymerase able to incorporate these nucleotides?
Thank you
Bernadette
Dear Bernadette,
Thank you for your interest in Trilink Biotechnologies. Your inquiry is being reviewed by our technical team. We will get back to you soon with more information.
Best regards,
Jessica
Dear Bernadette,
Thank you for your inquiry. Yes, 2-amino-2′-dATP is the dDTP that Suspene describes. We do not know for sure whether pfu polymerase is able to incorporate these nucleotides but it probably doesn’t. We recommend trying NEB’s Therminator.
Please let me know if you have any additional questions.
Regards,
Brea
Hi, can Trilink synthesize a RNA di-nucleotide containing at least one intrisically fluorescent ribo-nucleotide analogue?
Thank you
Dear Egor,
We are able to synthesize an RNA dinucleotide containing an intrinsically fluorescent ribo-nucleotide analog.
I have included a link to the product page for a few options we can offer:
2-Aminopurine-riboside: http://www.trilinkbiotech.com/cart/scripts/prodView.asp?idproduct=3051
Thienoguanosine: http://www.trilinkbiotech.com/cart/scripts/prodView.asp?idproduct=9776
Thienouridine: http://www.trilinkbiotech.com/cart/scripts/prodView.asp?idproduct=9610
For a formal quotation, please contact us through sales@trilinkbiotech.com
Best Regards,
Tiffany Teng
Product Specialist I
Can your company synthesize an RNA oligomer 5′-GCGCGC-3′ using modified 7-ethyl-7-deazaguanine for all the guanosines and N4-ethyl-cytosine for all the cytosines.
Dear Joshua,
Thank you for your interest in our modified RNA oligonucleotides. We can incorporate most commercially available phosphoramidate into an oligonucleotide or use a provided amidite. I was unable to find a source for the RNA version of the N4-ethylcytosine or 7-ethyl-7-deazaguanosine.
TriLink also offers custom amidite synthesis. This can be affordable if you foresee using the amidite frequently in the future to offset the total cost. Please contact us if you are interested.
Best regards,
Elizabeth
I have submitted an order through your oligo builder form with more information. The mentioned nucleobases can be found in this article. http://www.ncbi.nlm.nih.gov/pubmed/18448471
Dear Joshua,
Unfortunately we were unable to locate a commercial source for the 7-Deaza guanosine phosphoramidite modified with a ethyl group at the 7 position.
We are able to locate a commercial source for the following modified bases:
7-Deaza guanosine:
N4-Ethyl cytidine:
Please let me know if you would like a formal quotation using these modified bases.
Best Regards,
Tiffany Teng
Product Specialist I
Yes, I would like a formal quotation with those modified bases, but I would like to add more detail. The full sequence I would like is:
5′-CUUGCUGAAG*C*G*C*G*C*ACGGCAAG-3′
The stars after the nucleotides represent the desired modified sequence. All other nucleobases are normal. Is this possible?
Dear Joshua,
Thank You for your response, one of our Product Managers will be in touch soon to provide you with a formal quotation.
Best Regards,
Joey
Hi,
I ordered a RNA oligonucleotide with an internal 2-Aminopurine label. The oligonucleotide was PAGE purified and the final report says that the final salt form is Na+. Do I need to desalt prior to use? Is there any other procedure I need to do before working with the RNA?
Thank you,
Jorjethe
Dear Jorjethe,
Thank you for your question. Each custom oligonucleotide goes through a desalting step during the final processing before shipment to remove the excess salt and any remaining organic compounds. Some salt will remain as a counter ion to the negatively charged backbone.
Best regards,
Elizabeth
Is the DNA library ssDNA or dsDNA?
Based on the information you provided
DNA Template
5′ TAG GGA AGA GAA GGA CAT ATG AT(N20, N30 or N40) TTG ACT AGT ACA TGA CCA CTT GA 3′,
Forward Selection Primer
5′ TAG GGA AGA GAA GGA CAT ATG AT 3′
If the DNA library is single-stranded, how are the forward primers anneal to the single strand template library? Because sequences of forward primer are not complementary to the template library.
Please explain to me if I misunderstood something- Jaslan
Dear Jaslan,
We recommend use of the Forward Selection primer and the Reverse Selection primer to amplify the single stranded DNA template.
First the Reverse Selection primer will bind to the ssDNA template and create a complementary strand to which the Forward selection primer can then bind to.
DNA Template
5′ TAG GGA AGA GAA GGA CAT ATG AT(N20, N30 or N40) TTG ACT AGT ACA TGA CCA CTT GA 3′,
Forward Selection Primer
5′ TAG GGA AGA GAA GGA CAT ATG AT 3′
Reverse Selection Primer (20 nmoles)
PO DNA, 5′ TCA AGT GGT CAT GTA CTA GTC AA 3′
Best regards,
Sabrina Shore, MS
Hello,
I would like to know whether my calculations are correct on the mRNA oligo I ordered. It seems that we received only 0.2 umole when we ordered 1 umole. Could that be correct? On the certificate of analysis it says the “quantity in OD” is 57.2 Absorbance Units. The extinction coefficient is given to be 251.3 OD units/umole. If my calculations are correct, then we received 0.2 umole rather than the 1 umole ordered. Further, I measure the A260 to be 736.5 A260 units after bringing the sample up in 50 ul of water.
Thanks for your help,
Eileen Murphy (Brown University)
Dear Eileen,
Thank you for your inquiry. I have reviewed your recent order and I have the following feedback to offer you. Your quotation was for a 1.0 mole starting synthesis scale. This is the starting amount for the synthesis, it does not reflect the exact amount of product that will be yielded.
Research scale oligonucleotides are sold (by convention) by the starting scale, not the delivered amount. The reason is that each oligonucleotide is different, and will result in different yields, although the cost of material and labor is equivalent for similar constructs with the same starting scale. Therefore, the price is based on actual cost. If you need a defined amount of an oligonucleotide, please note clearly on your order that you are ordering based on the final quantity. We will then determine the scale needed to deliver that amount and price your oligo accordingly.
Typically our yields for a 1.0 mole starting synthesis scale, purified oligo are about 30 -60 OD260 units, or ~1-2 mg. Yields vary greatly depending on modifications and even on the sequence itself.
Sincerely,
Jessica Stewart
Asst. Product Manager
Which “High Fidelity PCR Master Mix” would you recommend using with the CleanTag Ligation Kit for Small RNA Library Prep? I noticed your protocol uses more than the volume that comes with the TruSeq Small RNA kit, so I was wondering which PCR MasterMix have you found most success with?
Hi Steve,
Thank you for your question. We recommend the Q5® High Fidelity 2x Master Mix (catalog # M0492S) from NEB for use with the CleanTag™ Ligation Kit for Small RNA Library Prep. You can view our full list of recommended reagents here.
Please let me know if you have any other questions.
Best regards,
Elizabeth
Does your company sell synthetic double stranded blunt end RNA oligos?
Dear Jennifer,
Thank you for your interest in TriLink. We can synthesize the two strands separately and anneals them prior to shipment to provide a double stranded blunt end RNA. Due to the nature of the project, please email sales@trilinkbiotech with your sequences, synthesis scale and requested purification to begin.
Best regards,
Tiffany Teng
Product Specialist I
Can you ship RNA oligonucleotides (10nt) to New Zealand? If yes what will the shipping costs be?
Thanks.
Dear Jack,
Thanks for contacting us. We can ship lyophilized RNA oligos to New Zealand by FedEx International Priority. The estimated freight cost to New Zealand is $65. The freight cost is based on FedEx daily rates and can vary depending on the shipping address. Please note FedEx does not allow dry ice shipments to New Zealand, so any product requiring dry ice would need to be shipped through a specialized courier coordinated by you.
You can request a quote for your 10 nt RNA oligo in OligoBuilder®. Please let me know if there’s anything else I can help you with.
Best regards,
Kaitlin
Is there a DNA or RNA aptamer that binds to beta-amyloids?
Thank you for you question. While TriLink does not develop or sell stocked aptamer sequences, I was able to find a publication from 2013 in the Neural Regeneration Research journal describing an aptamer against amyloid-beta peptide. Wang et. al. show that the TRX1-ABAD-DP-TRX2 peptide aptamer inhibits amyloid β peptide (Aβ) 42 toxicity and could lead towards a treatment for Alzheimer’s disease. Please let us know if you have any other questions.
Best regards,
Elizabeth
Does your company make pseudocomplementary peptide nucleic acids (pcPNA)?
Dear Joshua,
Thank you contacting TriLink. At this time we do not synthesis peptide nucleic acids (PNA). Please let us know if there is anything else we can help you with.
Best regards,
Elizabeth
Does Trilink provide LNA ATP or TTP？
Dear Miao,
Thank you for your interest in TriLink. Due to intellectual property rights, TriLink does not offer LNA triphosphates.
Best regards,
Elizabeth
I will like to ask if you have an already available thrombin binding aptamer.
We will like to purchase it for some preliminary work on our project.
Dear Caleb,
We have the ability to synthesis most aptamers but do not offer any stocked aptamers. We do offer Aptamer Libraries for identification of aptamers via SELEX.
You can find stocked aptamers through other companies including Aptagen. Please let us know if you have any other questions.
Best regards,
Elizabeth
Is there an advantage in using a c12 linker over c6 linker in coupling probes to magplex magnetic beads from Luminex. The objective is to develop a 34 target multiplex assay for detection of various viruses and bacteria using the MagPix instrument from Luminex. Thanks
Rachel
Dear Rachel,
Thank you for your question. We suggest using the C12-amino linker as recommended in the Luminex probe/primer design manual. It is likely that the protocol was optimized for this linker.
Please let us know if you have any additional questions.
Regards,
Brea
I just used your CleanTag Ligation Kit for Small RNA and I am trying to determine if the ligation/library prep was successful. Am I correct in assuming that I expect to see essentially no adaptor dimer formation in the prep? The TapeStation results show large (~2-4 ng/µl) peaks at around ~140bp for each sample (magnetic bead cleaned) and no obvious peaks at what would be the adaptor-dimer (~120bp).
I just wanted to confirm that because of the CleanTag chemistry, no adaptor-dimers form during ligation, and therefore, they aren’t amplified. Is this correct? If true, I should also be able to load these preps straight onto a sequencer with no gel purification of the 140bp band?
Dear Steve,
You are correct in that the CleanTag™ chemistry can fully suppress adapter dimer formation. If you are using very low input levels (less than 10 ng) you may start to see some adapter dimer but it should be minimal compared to amount of tagged library. Dilution of the adapters per the product insert is key to keep adapter dimer low at lower inputs.
Yes, you can load magnetic bead purified samples without gel purification directly onto a sequencer and get good quality sequencing data.
Best regards,
Sabrina Shore, MS
Scientist
Thank you for the prompt response!
I just ran the samples on a Bioanalyzer DNA high sensitivity chip as well, and i am seeing a strong ~140-143bp peak, but I am also seeing a 130 bp peak on all my samples (including human brain reference/positive control).
Any idea what this is and if it’s cause for concern? I should say that I input about 100 ng total RNA for each sample, diluted the adaptors 1:2 but ran PCR for 16 cycles (not 12-15). Next time I will shorten the cycle length, but I just wanted to know what this 130bp peak was and if it will cause issues.
We often see a small peak on the Bioanalzyer® around 130 bp as a shoulder of the library peak at 140 bp. We do not know what this is yet. We have noticed that in other commercial kits which have a significant amount of adapter dimer the 130 bp peak often goes unnoticed because it is hidden as a shoulder between the library and dimer peaks. It often does not get called as its own peak. The product is more obvious when using the CleanTag™ Adapters because there is no adapter dimer to mask it. We haven’t found reason to be concerned as it didn’t seem to significantly detract from miRNA sequencing reads after doing just a bead based purification.
We are currently looking into what the 130 pb artifact is. One hypothesis is based on literature which shows evidence of usRNA (unusually small RNA) which are slightly smaller than miRNA.
Sabrina
I ordered a RNA sequence labeled with a fluorophore and a quencher from TriLink. Does the Extinction Coefficient provided in the Certificate of Analysis include the absorbance of the fluorophore and the quencher at 260 nm? In other word, is the RNA sequence the only factor that determines the provided Extinction Coefficient in this case?
Dear Chunxi,
Thank you for inquiry. Our calculation of the extinction coefficient involves the sequence, dyes and quenchers. We’re happy to discuss your specific sequence with you over email. Please expect an email from our Product Management later today.
Best regards,
Elizabeth
Your technical report on oligonucleotide purity was very helpful. We use PAGE for size selection, but I was wondering if you comment on the error rate for substitutions, particularly for long oligos. Is it possible that the oligo will be of mixed composition, i.e. could 20% of the pool have the wrong base at a given position? Could you estimate the average number of errors one might expect in a 200mer and whether these could be mixed?
Dear Steve,
Thank you for your inquiry. We don’t calculate the error rate on a synthesis but based on historical information, the error rate you mention does not occur without being recognized and resolved. Our quality control on final products would show if there was high rate of substitution on a discrete sequence. An ESI-MS shows a single species to confirm synthesis of the correct product. If there was substitution as you mention, the data would be a skewed to look like a randomer.
Please let me know if you have any other questions.
Best regards,
Katelyn
Hello.
I am interested in an aptamer that would be able to detect a Salmonella typhimurium cell at one end and able to specifically hybridize to a ssDNA at the other end. Is it possible for you, and how difficult would that be for such an aptamer to achieve and maintain its 3D conformation in vitro?
Dear Aristea,
Thank you for your interest in TriLink BioTechnologies, Inc. Unfortunately, we do not offer aptamer design or selection services. We recommend Base Pair Bio who should be able to help you with your research needs.
We can synthesize the aptamer once the sequence is determined. Please let us know once you have a sequence identified and we will gladly provide a quotation.
Thanks,
Kaitlin
I would like to block ligation at the 3′ end of an oligo. The traditional way to block described in the literature is C3 spacer. I was wondering if I label the 3′ end of an oligo with the Cy5 dye, would the dye molecule effectively block ligation?
Thank you,
Chun-Nan
Dear Chun-Nan,
The blocking groups most often described in the literature are 3′ dideoxy-C, 3′ C3 Spacer (C3-OH) or 3′ Amino Linker (C6-NH2). All the mentioned modifications permanently block the 3′ hydroxyl group of the 3′ base. We can use the 3′ Amino Linker and label it with the Cyanine 5 dye which would continue to block the 3′ hydroxyl group.
Please contact us if you have any other questions.
Best regards,
Sabrina Shore, MS
Scientist, Research & Development
Hi,
I obtained a oligo from Trilink 47 bp in length with the presence of a random fragment that was 10bp.
Scale ordered: 0.2umole
Extinction coefficient: 457.1 units/umol
Od= 63.5
MW= 14334.9 g/mole
I calculated the molarity as umol= OD/extinction coefficieint
= 63.5/457.1= 0.138umol
To make 1mM of the oligo I added 138ul of water to the mixture.
Now total MW= 0.138 * 14334.9 = 1978.2ug
But as there are 138 ul each ul should have a concentration of 14.339 ug but each ul of my sample had 1ug concentration. Is there an error to my calculations?
Dear Anjali,
Thank you for your inquiry. A final concentration of 1 uM means you have 1 μmole or 14.34 ug per mL. Concentrations should be confirmed with OD readings of the final solution. Please remember, the extinction coefficient and molecular weight reported is calculated average and the final values of a randomer oligonucleotide may vary.
We’re happy to discuss how to measure the concentration of you solution. Please email us to discuss measuring the absorbance.
Best regards,
Elizabeth
Hi,
I want to add carboxyl-dCTP to the DNA fragments after RE digestion with Klenow. However, I saw that “5-Carboxy-dCTP is unstable in neutral and acidic conditions.” I wonder if 5-Carboxy-dCTP is stable in NEB buffer 2 (pH=7.9), or what is the best condition to do this.
Thanks.
Thank you for inquiring about 5-Carboxy-dCTP. The sensitivity to pH was determined during the synthesis. I have asked the chemist to review your question and provide any insights he may have.
Best regards,
Elizabeth
I’m still waiting for the response from the chemist.
Venson
Dear Venson,
Thank you for your patience during the holidays. 5-Carboxy-dCTP was functionally tested when it was added to our catalog.
In a single pase pair extension assay, 5-Carboxy-dCTP incorporated less efficiently than dCTP with Klenow using a buffer of pH 7.9. 5-Carboxy-dCTP was also tested in PCR amplification of a ~500 base pair Lambda gDNA in a pH 8.4 buffer. The PCR product formed with 75% substition of dCTP. Our chemists believe that 5-carboxy-dCTP should be stable enough in NEB buffer (pH 7.9) to be used with Klenow DNA polymerase but please remember to store the product at -20°C.
Please let me know if this provides adequate information for your experiments.
Best regards,
Elizabeth
Hello,
I’m working with magnetic nanoparticles (10 nm) for hyperthermia approaches and I want to functionalize (coat) it with DNA (aptamer). what is the best conjugation method that could be used? please, i need a protocol indicating the type of DNA modification (e.g Thiol, Amine,… etc) and its corresponding surface functional groupe (e.g Hydroxide, Amine,… etc).
Thank You
Dear Mahmoud,
Thank you for your inquiry. TriLink is able to offer different attachment chemistries. Based upon your application, we would match up the functional group on the oligo based upon the reactive group of the magnetic nanoparticles. Some possible chemistries include Thiol/Maleimide or NHS-ester/primary amine of a linker.
TriLink’s DADE (decanoic acid diester) linker offers a novel way of preparing conjugates more economically and with much more flexibility. We can readily prepare 5′ carboxyl linkers. This linker can be used to conjugate to amines using conventional carbodiimide chemistry. Though less convenient than the solid phase method described in DADE: A Pre-activated Carboxyl Linker, Applications and Methods, solution phase methods may be necessary at times. The DADE linker is also useful for conjugation to amine bearing molecules.
We can also employ other attachment chemistries if you can provide the reactive group on the nanoparticles. Please contact our Product Management group to continue the discussion.
Best Regards,
Katelyn
I have ordered 5’end-modified RNA oligonucleotides and would now like to 3’end label them. Unfortunately, I cannot find any info on the nature of the 3’end of your RNA oligos. Is it a standard -OH group?
Many thanks,
Eva
Dear Eva,
Thank you for your interested in our RNA oligonucleotides. You are correct, the 3′ end of an unmodified oligonucleotide would be the terminal base in your sequence with hydroxyl groups (-OH) on the 2′ and 3′ sugars.
We also offer a variety of linkers that can be used to have different chemistries on the 5′ and 3′ end of an oligonucleotide. You can use an amino linker for reactions with and activated carbonyl and a thiol linker for reactions with maleimides. The order of the chemistry performed is important as a maleimide will react with the free amine.
Please let us know if you’d like to discuss your project or quote a new oligonucleotide.
Best regards,
Elizabeth
Hi, It’s my frist time to work with Elisa. My work was to quantify IgA in pig saliva by developing an Elisa (D-Elisa) and compare it with commercial Elisa kit (C-Elisa) as reference test. Results (IgA conc.) were pretty same by both elisa system with an acceptable inter-assay CV and intra-assay CV. I have some questions about the validation analysis of my D-Elisa.
1. How to calculate the relative sensitivity & specificity of D-Elisa with respect to C-Elisa?
2. IgA is predominant in pig saliva. But, In a few samples, both system couldn’t detect any IgA. Is it possible to consider those result as false negative? Or how to deal with these data?
3. For C-Elisa, LOD (15 ng/ml) was mentioned in the manual instruction. But How can I calculate LOD myself from the calibration curve? I also want to calculate sensitivity & specificity of C-Elisa. How can I do this if it’s possible?
4. In literature I found that cut off value is usually calculated to differ the positive & negative sample and this way to calculate sensitivity & specificity. But I tested all unknown samples. Do I need to calculate cut off value for my elisa?
(just to let you know) In C-Elisa:
Blank well (as background) : mean OD 0.0590 and SD 0.0056
zero standard: mean OD 0.0633 and SD 0.0035
Lower limit of Detection: mean OD 0.3925
Thanks.
Paul
Dear Paul,
Thank you for your questions. Unfortunately, TriLink does not have expertise in ELISA and we cannot provide you with an adequate answer. I have provided a link to a resource that may provide the information that you are looking for. I am sorry that we could not help you more.
Regards,
Brea
I have been reading about aptamers, with the hope of working with them in our lab soon. As i understand, the three dimentional conformation taken up by an aptamer on binding to its target remains the same, through every batch of that aptamer synthesized. I could not however find an article about this. Could you help me with this please?
Best
Swan
Dear Swan,
Thank you for your questions regarding aptamer conformation. Aptamer conformation is not straightforward, as a given sequence can take on multiple conformations. While some aptamers maintain one primary conformation, others do not. The secondary structure can depend on the actual sequence of the apatmer as well as external factors, including the pH and composition of the dilution buffer. In regards to whether aptamers can behave differently due to batch to batch variations, one can imagine a scenario where purity may influence structure and function. However, in general the synthesis should not affect aptamer conformation. Interestingly, we too were not able to easily find any online literature that specifically documents this phenomenon, though The Aptamer Handbook, edited by Sven Klussman presents a lot of useful information on aptamer activity, selection and design.
Please let me know if I can help you further.
Regards,
Brea
In order to obtain accurate concentration measurements using extinction coefficients provided by Trilink Biotech, what variables need to be held constant? I am assuming that extinction coefficients are determined experimentally by Beer’s law, when volume and path length are held constant. Can you provide details?
Thank you,
Jacob Sieg
Dear Jacob,
Thank you for your question. TriLink calculates the extinction coefficient of an oligonucleotide by using the nearest neighbor method and reports it on the Certificate of Analysis. You can learn more about extinction coefficients in our Technical Article, An Introduction to Extinction Coefficients and Molecular Weights of Oligonucleotides.
After diluting an oligonucleotide, the concentration can be determined by measuring absorbance with a spectrophotometer with UV lamp and quartz cuvette. Beer’s law can be used to calculate the concentration. If your oligonucleotide was supplied lyophilized, I recommend diluting to your preferred concentration using the method described.
Please let us know if you have any further questions.
Best regards,
Elizabeth
Do you know if the aptamers of the SELEX library can distinguish between two peptides with a single aa change, between Gly and Pro. Is there any way compare the likelihood of a certain site to fit such recongnition? Is it different between 20/30/40 nt libraries?
Thanks- Eyal Fridman
Dear Eyal,
Thank you for your interest in TriLink’s Aptamer Libraries. The complexity of the final library varies with the random region length. Libraries with longer random regions have more unique sequence motifs than libraries with shorter random regions. However, not all possible unique sequences can be represented in each selection. In contrast, libraries with shorter random regions will give you a better representation of all possible sequences but are inherently less complex than a library with a longer randomer region. However, once an aptamer is selected shorter aptamers are easier and less expensive to synthesize
Aptamers have been designed to bind to specific amino acids. Geiger et. al. found an aptamer that distinguished with a 12,000-fold improvement between L-arginine and D-arginine. I don’t know the specific discrimination between Proline and Glycine. It would need to be determined experimentally. Proline and Glycine have different structures but the location within the protein and the protein folding may affect the ability to find an appropriate aptamer.
I wish I had more specific information to share and good luck with your experiments.
Best regards,
Sabrina Shore, MS
I would like to order 3′ dideoxy terminated oligos. Only the cytosine is listed under 3′ mods. Can I get the dideoxy-A, G and T as 3′ mods?
Dear Chris,
Thank you for your interest in TriLink. Currently 2′,3′-dideoxycytidine is the only commercially available support. If you’d like to discuss your project, you can request a quote and our Product Management can review possible alternatives.
Have a great day!
Angela
Dear Angela
Thank you!
I have make a contact with your salesman.
Best wishes!
You are welcome! Thanks again for your interest in TriLink.
Kind Regards,
Angela
Do you have dDTP, that is, 2′-deoxy-diaminopurine 5’-triphosphate sodium salt solution?
Dear Dr. Xusheng Qiu,
Thank you for your inquiry. We can prepare our triphosphates as the Li+, Na+ or TEA salt form. I believe our dDTP is currently in the Li+ salt form. I will have our technical support team contact you regarding preparing the Na+ salt form.
Kind Regards,
Angela
I would like to request quotation for a thiol-modified oligonucleotides. Is it possible to cross link the thiol-modified oligos to gold surface with succinimidyl 4-[maleimidophenyl]butyrate (SMPB)? What is the differences between 3′ C3, 3′ C6 and 3′ C6 Disulfide linker?
Thank you.
Dear Lim,
Thank you for your interest in TriLink’s custom oligo synthesis. The three thiol linkers you mention differ by the position on the oligonucleotide (5′ or 3′) and the linker length (3 or 6 carbon chain). The structure of the reduced thiol linker can be found on each product page. Thiol modified oligonucleotides are shipped as the protected thiol (for example, C6-S-S-C6, aka disulfide) to avoid dimerization. Prior to use, the disulfide can be reduced using TCEP. Thiol modified oligos can be ordered through OligoBuilder®.
Thiol modified oligos can be direclty linked to a gold surface as described by Li Z, Jin R, Mirkin CA, Letsinger RL. .
Please let us know if you have any additional questions.
Best regards,
Elizabeth
Hi TriLink,
We are interested to order 5′ Maleimide-modified oligonucleotides to label them with a thiol-reactive reagent for RnD assays. If we supply the thiol-reactive reagent, do you are able to deprotect the maleimide, to make the conjugation with our reagent and to purify the conjugated product (by reverse-phase high-performance liquid chromatography, for example)?
Best regards,
Michael
Dear Michael,
Thank you for your interest in TriLink and the 5′ Maleimide-modifier. TriLink specializes in working closely with our customers for the individual requirements of each project including working with customer supplied material for various types of reactions.
A Product Management Specialist will be in contact via email to discuss the specifics and technical aspects of your project.
Best regards,
Elizabeth
I want to order some primers for the detection of mtDNA damage in both rat and human. There are some mitoPrimers™ Available in the website of your company, such as A1, B1 or C1. I want to know that do these primers work for both rat and human? Thanks!
Dear Yun Hui,
Thanks for asking about our mitoPrimers™. mitoPrimers™ were designed based on the Hypervariable 1 and 2 regions of human mtDNA to prevent any cross-species amplification between species.
I compared the A1 and CA mitoPrimers™ to the Rattus norvegicus mitochondrial genome and found that the A1 mitoPrimer™ aligns with two mismatched base pairs. The C1 mitoPrimer™ did not align. I would recommend you compare the primer sequences to your specific rat genome using BLAST to determine if the mitoPrimers™ are compatible.
Please do not hesitate to contact me with any further questions.
Best regards,
Sabrina Shore, MS
Senior Research Associate
Hello TriLink,
Do you synthesize random nonamer with a 5′ DNP modification, similar to the Cy3 or Cy5 random nonamer that was used with NimbleGen labeling methods, except with dinitrophenol (DNP).
Thank you
Anne
Dear Anne,
Thank you for asking about our stocked oligonucleotides. We do not offer a 5′ DNP random nonamer but you can order one using OligoBuilder®. The DNP modification can be found within the Non-Fluorescent Conjugates subsection of the Modification menu.
Please let me know if you have any other questions.
Best Regards,
Elizabeth
I want to synthesize short mRNA in vitro using DNA templates, which genes should I use to be transcribed to a short functional mRNA?
Dear Dela,
Thank you for your inquiry. I believe that you are referring to the elements needed in your transcription template to create a functional mRNA. These are located upstream or downstream from your open reading frame (gene). If this is what you are referring to, I have listed the elements below.
Your mRNA transcription template must include:
1. Promoter, preferably the T7 promoter
2. 5′ untranslated region with a strong Kozak sequence
3. ORF beginning with a start codon and ending with a stop codon
4. 3′ untranslated region
5. Poly(A) track top strand (this is not the same as a poly(A) signal)*
6. Unique restriction site at the end of the cassette that is suitable for linearization
*Most plasmids designed for expression in a eukaryotic cell contain a poly(A) signal rather than a poly (A) stretch. If you do not have a poly(A) track in your plasmid a poly(A) tail must be added through a poly(A) polymerase reaction.
If this is not the information you were seeking, please email info@trilinkbiotech.com and our technical team will assist you.
Best Regards,
Brea
Brea Midthune, Ph.D.
Business Development Analyst II
Hello,
I would like to synthesize the following oligo:
5′-CAGGGGCCTACACGTTGTA-3′
The problem I understand is the 4 Gs (starting at base 3) in a row will potentially cause synthesis issue. Also this G-quadruplex will potentially form undesirable secondary structure for PCR applications in the presence of potassium.
http://en.wikipedia.org/wiki/G-quadruplex
To mitigate, I learned that it’s possible to synthesize an oligo with a G analog, such as 7-Deaza-2′-deoxyguanosine to lessen the chance for the potential problems mentioned above.
If this analog indeed is the best course of action, what’s the best position(s) to insert this G analog, and how many to insert? However, I also read inserting multiple 7-Deaza-2′-deoxyguanosine could be problematic because 7-deaza-dG is sensitive to the iodine-based oxidizer solution used in phosphoramidite-based DNA synthesis. So, a suggestion is to substitute 7-deaza-dG with 7-deaza-8-aza-dG, which I’m not sure you have available as an option.
I would very appreciate your thought on this matter.
Thank you,
Chun-Nan Chen, Ph.D.
CEO & Chief Scientific Officer
Single Cell Technology, Inc.
6280 San Ignacio Ave. Suite E
San Jose, CA 95119
Mobile: (408) 642-9741
Email: chunnan.chen@singlecelltechnology.com
Dear Chun-Nan,
Thank you for your interest in TriLink. Poly guanosine and deoxyguanosine stretches have the propensity to form tetraplexes (complexes consisting of four different strands all bound at the poly G region). These complexes are very tight and make oligonucleotide synthesis difficult.
The use of 7-deaza-dG during PCR reduces the secondary structure but, unfortunately, the 7-deaza-dG and 7-deaza-8-aza-dG amidites have the same innate properties as guanosine during oligonucleotide synthesis. Synthetic and processing capabilities would still be problematic. For multiple incorporations of 7-deaza-dG, CSO is recommended as the oxidizing solution to combat degradation.
TriLink has devised specialized protocols for multiple and/or consecutive insertions of guanosine or 7-deaza guanosine. Due to the complexity of manufacturing, there is typically reduced yield or purity compared to a sequence with better base distribution. The number of incorporations of guanosine, 7-deaza-guanosine and/or 7-deaza-8-aza- guanosine will determine the final effect.
I would recommend trying the unmodified compound before proceeding with the modified version as the cost of the modifications will lead to an overall higher price.
Best regards,
Katelyn Murphy
Product Manager
Hi,
I am interested in the stocked aptamer libraries. I have two questions, firstly do you have any publications resulting from the stocked library and secondly with the NdeI and SpeI sites, do you know of a commercially available E.coli vector which has these multiple cloning sites?
Cheers
Chris
Happy New Year!
I would like to order a DNA oligo which contains 12bp random nucleotides (Ns) in the middle, if I wish to have all 4^12=16777216 possible oligos, what synthesis scale order I should place with you guys? Can you tell me how could assure that? Thanks a lot!
Lisa
Dear Lisa,
Thank you for interest in our randomer service. The expected yield of our various scales can be found on the Phosphodiester Product Information. An 0.2 μmole HPLC purified, DNA synthesis typically yields 5-15 OD260 units which is 25-75 nmoles of final product for an oligo with an extinction coefficient of 200 OD260/μmole. 25 nmoles of product is equivalent to 1.5 x 1016 sequences. You would expect on average 9.0 x 108 copes of each of your ~1.7 x 107 possible sequences within the 25 nmole yield.
TriLink has done extensive research to optimize the “n” wobble (A, C, G, T) to achieve as close to a 1:1:1:1 equal ratio as possible in the final oligo product. We also offer an enzymatic digest assay which measures the base distribution of the final product. You can order your oligo through OligoBuilder® and include your yield requirement and if you are interested in an enzymatic digest in the Notes.
Best regards,
Natasha Paul, PhD
I have been trying to make mRNA through in vitro transcription while substituting U with pseudouridine and C with 5-methylcytidine. However, yields are much lower than when using all natural nucleotides, and 260/280 is 1.5 instead of about 2.0 I get when using natural nucleotides, and the RNA looks shorter on gel. In an earlier question by Peizhe Wang, you suggest avoiding freeze thaw cycles and RNAse contamination by aliquotting the nucleotide mix into several tubes before using any for RNA synthesis, but I did that before I saw that suggestion here. I don’t have enough of the modified nucleotides to optimize the reaction very well on my own, so I need a better starting point. I have been using the Ambion T7 megascript kit, and it works fine for natural nucleotides, I have been getting 100 – 150ug RNA per reaction. Do you have any suggestions for making it work well with modified nucleotides?
Dear Samuel,
Thank you for your question. The inclusion of modified bases in a transcription can alter several parameters. If you are including ARCA in the reaction and reducing the GTP (e.g. 4:1 ARCA:GTP) in order to give good capping, this will reduce your expected transcription yields by about 3-4 fold. In our hands, full substitution of U and C with pseudo-U and 5-methyl-C do no significantly reduce transcription yields. For an ARCA capped mRNA, fully substituted with pseudo-U and 5-methyl-C we typically see crude yields of 1.5-2 mg/ml of transcription. We optimize transcription reactions by varying the MgCl2 concentration. 4-6 mM over total NTPs usually works well.
With regards to the 260/280 ratio, the extinction coefficients and lambda maxes of pseudo-U and 5-methyl C differ from U and C. The lambda max for pseudo-U is 265 vs 262 and 5-Methyl-C is 279 vs 271. Thus, pseudo-U and 5-methyl-C substitution would be predicted to give you a higher 260/280 ratio than normal NTPs. If you are observing a lower 260/280 ratio, this might mean that you are actually doing a better job of removing protein in this prep. I would not be concerned by this.
With regard to mobility, we do sometimes see that some modifications change the mobility of the RNA on gels. Base modification can change the secondary structure of the mRNA and thus the mobility on non-denaturing gels. We recommend glyoxal treating the mRNA with NorthernMax®-Gly Loading Dye and then running it with NorthernMax® 10X Running Buffer (do not use TAE or TBE).
I hope this information is helpful. If you continue to have problems, you could considering order a custom mRNA.
Best regards,
Anton McCaffrey, PhD
Principal Scientist
I want to order the following
P75 antisense
5’-ACC TGC-CCT CCT CAT TGCA-3’
p75 nonsense
59-CTC CCA CTC-GTC ATT CGAC-39
and 2 to sonic hedge hog
5′-GAATTCTTGTCAACAG-3′
and
5′-GGTCAGCTTTTTGGG-3′.
Can I order them through you?
Dear Jennifer,
You can order a synthesis of each of the oligos you need through our OligoBuilder® system. OligoBuilder® will provide a price based on the scale and purification required. If you unsure of the scale, you can include the amount of material needed in the comments sections.
You can reference our OligoBuilder® Help Section or contact us if you’d like a further explanation.
Best regards,
Elizabeth
Do you recommend making an OD320 or OD340 subtraction correction when calculating the concentration of an oligo solution? I am specifically interested in measuring the concentration of T16 oligo accurately. Thanks.
Dear Andrew,
Thank you for contacting TriLink with your question. Our Director of Manufacturing does not recommend making a subtraction correction. Please contact us if you have any other questions.
Best regards,
Elizabeth
Dear Andrew,
I wanted to follow up specifically on your question regarding the T16 oligo. Since T absorbs at 260 nm, we recommend taking concentration measurements at that wavelength. If you are trying to employ a subtraction correction for a specific buffer, I recommend contacting us so we can discuss your exact situation.
Best regards,
Elizabeth
Dear TriLink,
For the 3′ biotin TEG modification, is the biotin TEG directly off the 3′ end? Or is there an intervening phosphate, such as is pictured for the 5′ modification?
If not, is it possible to have the 3′ end first phosphorylated and then modified with the biotin TEG?
Thanks for your help!
Molly
Dear Molly,
Thank you for your questions. The 3′ Biotin TEG modification does include a phosphate group between the TEG linker and the first nucleotide in your sequence. We look forward to helping you with your project!
Best regards,
Elizabeth
Hi,
Is it known whether 7 deaza dGTP will interfere with cytosine methylation by DNA Methyltransferase, which recognise CG dinucleotides?
Thanks,
Aaron
Dear Aaron,
Thanks for the question. I discussed this with our research chemists and biologists. We found a paper by Clark et. al. which studied the affect of different analogs on DNA methyltransferase. While they showed that dG and 7-deaza-dG will inhibit methyltransferase to a similar extent, they did not review the scenario where dC is upstream from 7-deaza-dG. The findings show that dG and 7-deaza-dG have similar properties and therfore, dC followed by 7-deaza-dG may be tolerated by the DNA methyltransferase. The only sure answer can be found by experimental testing. Please let me know if you’d like to discuss this further.
Best regards,
Elizabeth
Dear TrilinkBiotech staff,
I recently bought carboxyl dCTP and tried wiith different polymerases however I was unable to amplify my construct. I tried also C, meC, hmC, fC and they worked fine with AccuPrime, but nothing to do with caC. What do you suggest? Any advice on which polymerase I can use?
Thank you in advance
Dear Robert,
Thank you for contacting TriLink. I am not aware of any specific enzyme which is known to incorporate 5-carboxy-dCTP however; since different analogs incorporate with different efficiencies, I recommend performing some initial PCR experiments using natural:modified dNTPs in ratios such as 1:0, 3:1, 1:1, 1:3 and 0:1 to identify the best conditions. Alternatively, decreasing the elongation temperature, increasing elongation time in PCR cycle, increasing concentration of dGTP and 5-carboxy-dCTP or adjusting the pH may support incorporation. Please keep in mind this modification is sensitive to pH and should be kept in basic conditions. Do not hesitate to contact us if you have any further questions.
Best regards,
Elizabeth Hill
Dear Sir,
My husband has cancer. A Japanese chemist friend of ours, Alan Kono, sold Oligo Powder in the 1990’s. If I remember correctly, people had remission from cancer. Do you know how much powder to mix with liquid (water) and how many times a day? I still have some powder sealed. I know first hand it was an amazing product. Please respond.
Sincerely,
Beryl
Dear Beryl,
I am very sorry to hear of your husband’s illness. Much of the research I conducted in my career has been directed towards the development of drugs for the treatment of various cancers. It is a demon I have long sought to conquer. Unfortunately, our firm does not sell the product you are interested in. We make oligonucleotides, which are short fragments of synthetic DNA and RNA.
The oligo powder you refer to is a completely different type of product. I looked it up and found that the term “oligo powder” can refer to a wide range of different products. The term “oligo” is Greek for many, and is used in science to refer to compounds that have multiple units of the same molecule attached to one another to form chains. For instance, a very common “oligo powder” is made with oligosaccharide, a sugar. Another is oligo chitosan powder. Yet another is made from oligo proantho cyanidin powder.
As to your specific question regarding the preparation of the powder, I must admit to having no knowledge at all about it. I did a basic search of the literature and found this obscure link to a PhD thesis in the Netherlands that may refer to the science behind the use of oligosaccharide powders for medicinal use. It refers to work by Kono.
I also found this link which describes the uses of this particular powder, but no mention of a cancer application. It does give a maximum dosage of 30 g per day. The concentration in water is probably dictated by solubility properties and your husband’s palate.
My guess is that this treatment was never approved by the FDA and therefore has fallen into obscurity. Many useful products end up disappearing in this fashion.
I am sorry I cannot be of more help. I wish you and your husband the best of luck. Please let us know if you find the answer you seek.
Best regards,
Richard Hogrefe, Ph.D.
CEO/President
Do you have a nucleotide modification that I can use for PCR incorporation that prevents further DNA amplification but is also a reversible modification? I would like to only amplify my original template but later use the DNA for sequencing reaction.
Dear Pete,
Thank you for your question. The only analog that has the properties you described is our CleanAmp™ dNTPs. Although the protecting group will not be stable during the elevated temperatures of PCR, certain enzymes such as the Therminator series of enzymes can incorporate this type of analogs. However, incorporation would need to be performed at low temperatures, such as at room temp. Then, a heat activation step can be used to remove the protecting group.
Please let me know if you like to discuss further.
Best regards,
Natasha Paul, Ph.D.
Dear TriLink,
we are trying to introduce aptamers as sensitisers into electronic transducers. We are looking for an aptamer that can be immobilised onto a metal (not so important what metal), and selectively binds to a biomedically relevant analyte in aq. solution (saline, or buffer).
Suggestions?
Dear Martin,
Thank you for your question. The first step is to identify the aptamer for the analyte of choice using one of the many selection protocols available. We recommend that you use a random library with no more than 40 random bases. Longer ones will yield aptamers that will be more difficult and expensive to prepare synthetically, especially if the aptamer is heavily modified. You can review our stocked libraries to see if one may be used during your selection.
Once you have the sequence, it is fairly easy for us to modify your aptamer with a reactive moiety for conjugation to a metal. For instance, we can put sulfur on the aptamer for direct conjugation to a gold particle. Once you have identified the metal(gold is well established in the literature) we can help with the decision regarding chemistry.
I hope this helped. Please contact us for more details.
Best regards,
Richard Hogrefe, Ph.D.
CEO/President
We are currently searching for an RNA with a Poly (A) tail that can be used in our RNase test kit. It would be a 3’ poly(A) tail that is added to the end of the pre-mRNA.
Is this a product that you currently manufacture and if yes would you be able to provide us with a pilot lot to assess within our test kit??
We are looking to move on this ASAP so any information you could provide would be greatly appreciated.
Dear Donna,
Thank you for your interest in our RNA transcription service. Please submit a quote request with the details of your project to initiate discussions with our Product Management Team.
Best regards,
Elizabeth
I’d like to order a DNA (beacon type) with a quencher conjugated at 3′ and an amino modifiers C6 (MMT) at 5′. Do I have to activate the amine group so as to go further conjugation or the product is delivered with the ready-to-conjugate amine group?
Thank you
Dear Grace,
Thank you for your interest in TriLink. A 5’ amine modified oligonucleotide will be delivered ready to conjugate to a succinimidyl ester.
Please keep in mind that TriLink can perform the conjugation and purify the final product for you. We can conjugate most commercial succinimidyl esters or one you supply.
When you are ready to order your oligo, please visit OligoBuilder®. If you would like TriLink to conjugate your succinimidyl ester, please submit a quote request. We look forward to working with you.
Best regards,
Elizabeth
I have dissolved biotin oligonucleotide labelled using vortex. ¿Is it correct?
Dear Araceli,
Thank you for contacting us. Vortexing is an acceptable method for dissolved your oligo. We recommended reconstituting oligonucleotides in a neutral pH buffer. Vortexing or pulse spin is acceptable to ensure there is no lyophilized solid remaining. Please contact us if you have any additional questions.
Best regards,
Elizabeth
Dear Trilink,
I usually order (DNP-TEG)-labeled probes and the QCs are a PAGE and mass Spec analysis. Can you provide a purity level with each order, that I could use as a reference?
Thank you,
Aurelie
Dear Aurelie,
Thank you for your question. We run mass spec and PAGE analysis on every oligo ordered as part of our quality system. The PAGE analysis allows qualitative assessment and mass spec confirms identity. An HPLC or gel densitometry is required for quantification of purity. HPLC and other analytics can be requested at the time of order. If you are not sure which analytical would be best for your requirement, just ask!
In regards to the DNP-TEG labeled oligonucleotides, we recommend requesting an AX-HPLC analysis. If you have samples of the oligos previously synthesized, we can run an AX-HPLC on each. We look forward to continuing to work with you.
Best regards,
Elizabeth
Dear Trilink
I’d like to know if 35-sulfur labelled 2-O-methyl RNA synthesis is available.
I look forward to hearing from you. Thank you.
Sincerely
Jae-jun, Ban
Dear Ban,
Thank you for your inquiry. We have synthesized 2′-O-Methyl RNA oligonucleotides with 35-sulfur labels in the past. Please submit a quote request to discuss your project.
Best regards,
Elizabeth
TriLink,
I am currently working to synthesize biotinylated DNA probes, and I was hoping you could elucidate how you quantified the samples in “PCR incorporation of modified dNTPs: the substrate properties of biotinylated dNTPs” (http://www.trilinkbiotech.com/work/biotinwhite.pdf) Thank you.
All the Best,
Josh Smith
Dear Josh,
Thanks very much for writing in with your question. In this whitepaper, we quantified the amount of amplicon formed as a function of the amount of input biotinylated nucleotide by gel densitometry. In particular, the percent amplicon yield for a given percentage of biotinylated nucleotide was normalized to an reaction which contained only natural nucleotides.
While this approach can be used to identify optimal reaction conditions that will allow for biotinylated nucleotide incorporation in PCR without sacrificing amplicon yield, this does not measure the amount of biotin in the PCR product itself. Should direct quantification of the biotin content be of interest, enzymatic digestion of the isolated product is one way to do this. Eadie, et. al. and Andrus, et. al. describe this technique in their publications.
Please let me know if you have any follow-on questions.
Good luck with your experiments!
Natasha
Dear TriLink,
You state on your website that 6-FAM is less susceptible to photobleaching than other fluorescein dyes (http://ask.trilinkbiotech.com/?page_id=124). Where can I find the reference for this?
Best regards,
Shane
Dear Shane,
Thank you for your interest. Photobleaching of different fluorophores has been reviewed for use in a number of applications including quantitative microscopy and fluorescence photobleaching recovery (FPR). Dailey, et. al. reviewed studies of photobleaching in different systems, as well as different methods employed to reduce photobleaching.
While 6-FAM is less susceptible to photobleaching than FITC, newer dyes have been developed that are more stable. For example, Panchuk-Voloshina, et al. demonstrated the stability of Alexa Dyes over FAM and FITC.
Please contact us if you would like to discuss the best fluorophore for your projects.
Best regards,
Elizabeth
i want to prepare a primer with initiating an amino acid like –aa-n1-n2-n3—–
(n denotes a nucleotide).
which aa. is suitable and how can it prepare.
so after pcr amplifcation particular aa. used as biomarker
Dear Rakesh,
Thank you for your inquiry. An oligonucleotide modified with a 5′ adenylate can be coupled to a peptide via a N-terminal cysteine, aminooxy or hydrazide group on the peptide. This chemistry is described by Zatsepin et. al.
You can purchase your peptide from a variety of manufacturers including PolyPeptide, Sigma or AmbioPharm. A more comprehensive list can be found at Peptide Resource. Please let us know if you have any additional questions.
Best regards,
Elizabeth
Can you prepare either tritiated, 35S or alpha 32P labelled 4 thio UTP. If so, could you send me a quote.
Thank you
Dear Leonard,
Thank you for your interest in TriLink. While TriLink does offer some custom radiolabeling, our license does not allow for 35S labeling of nucleoside triphosphates. Currently TriLink offers 35S and 3H labeling of phosphodiester and phosphorothioate oligonucleotides.
We recommend contacting Moravek Biochemicals for other radiolabeling services. Here is a link to their website: http://www.moravek.com/
I am sorry I could not be of further assistance. If there is anything else I can help you with please let me know.
Sincerely,
Jessica Stewart
Product Specialist II
Dear Liz,
Thansk for your answer. I have put 1-thio-dATP at the ends of a dsDNA by klenow exo-. I was hoping to get dA-p-SS-p-dA by oxidation with a strong oxidative agent(H2O2 or KI). It seems based on your answer that this is unlikely. Do you have another product that I can use for coupling two ends of a DNA by a quick disulfide bond formation?
Best Regards,
Reza
Dear Reza,
I asked our research team to review your request. Our scientisted reviewed our thio-labeled triphosphates and publications for a procedure that may work. A disulfide bond can be created between two ends of DNA if synthesized with terminal thiol linkers, however this is only applicable if you material can be synthesized using oligonucleotide chemistry. If you would like to further discuss your project in detail, I recommend sending an email to info@trilinkbiotech.com for discussions with our R&D team.
Best regards,
Liz
I am hoping that you can synthesize an modified oligo for me. I need dimethylphosphonate in 5′ end.
Could you synthesize it?
Dear Yibin,
Thank you for your question. If there is a commercially available phosphoramidite or conjugate we can incorporate the material into an oligo. Our Product Management team is researching this modification. If the material is not commercially available, our custom chemistry group can synthesize an amidite for your use. In the meantime, if you could provide any references regarding the modification, we can review the options.
Best regards,
Liz
Hi,
I have a question regarding 1-thiol-dATP (N8001). I see that the product is kept in water. Isn’t that in the absence of DTT the S groups will form disulfide bonds?
Second, can this modified dATP be incorporated into a dsDNA by Klenow (or Klenow exo-)?
Best Regards,
Reza Afra
Reaserch Assistant in Dept of Physics
Purdue University
Dear Reza,
Thank you for your inquiry. 1-Thio-dATP (N-8001) will not form a disulfide bond in the absence of DTT. However, if it is degraded to the monophosphate version, there is an unlikely possibility to form symmetrical dA-p-SS-p-dA.
1-Thio-dATP is shipped as the mixture of two stereomers. One of these is a substrate for Klenow or Klenow exo-. Please contact us if you have any other questions.
Best regards,
Liz
Hi,
We ordered a set of CleanAmp primers, and received them resuspended in 100% DMSO. Most typically, we resuspend our primers in TE Buffer, and dilute with water to a 25uM working stock, and a final concentration of 1uM in the PCR reaction. Will resuspension in DMSO be a problem?
Thanks,
Cody
Hi Cody,
Thanks for your question. CleanAmp™ Primers are supplied in DMSO to increase the stability of the CleanAmp™ modification. We suggest storing the primers in the DMSO stock solution and diluting only as needed. You can make a stock solution of the primer quantity needed by diluting the primers with water or TE buffer to a working concentration of 25 uM.
We recommend that CleanAmp™ primers be used in PCR at a concentration from 0.1-0.5 uM but we have found the primers can be used at concentrations up to 2 uM without seeing an effect from the DMSO. For further information you can review the CleanAmp™ Primer Product Manual. Please let me know if you have any other questions.
Best regards,
Elizabeth
I am hoping that you can synthesize an mRNA for me. What is the limit of length for your service? My ORF (from start to stop) is 3845 nucleotides long. I have in an IVT vector but have not been able to get full length product.
Dear Miguel,
Thank you for your interest in TriLink’s RNA transcription services. The T7 RNA polymerase used in our transcription is a fairly processive enzyme that allows for the successful synthesis of mRNA in the range of 4,000 bases. Final yield per milliliter of transcription tends to be lower for long sequences. And the ability to obtain full length product depends on the presence of transcription stop sequences within your transcript, i.e. strong hairpins. If you would like to further discuss your mRNA, please submit an online quote request.
Best regards,
Anton
Hello to TL team.
I am wondering about the relative stability of standard dNTPs and CleanAmp dNTPs stored wet vs. dried.
Thanks Mike
Hello Mike,
Thank you for your inquiry. When stored and handled properly, stability of standard dNTPs and CleanAmp™ dNTPs is comparable. In both cases, it is the triphosphate chain that is most susceptible to degradation. When lyophilized (or dried) appropriately, both are very stable. In solution, CleanAmp™ dNTPs are as stable as standard dNTPs provided they are stored in relatively basic conditions, at least pH 8 to protect the CleanAmp™ modification from deprotection.
Kind Regards,
Angela & Natasha
Does BHQ-1 require a linker for internal labeling of an oligo? How about 6-FAM? Do you have any information on how far from an end an internal label should be so that it doesn’t interfere with ligation?
Dear Grant,
Thank you for interest in TriLink. Black Hole Quencher 1 and 6-FAM can be placed internally in an oligo either with conjugation to an amine modified base, thymidine residues or by an internal amidite.
For ligation, the modifications should be positioned outside of the footprint of the ligase on the nicked DNA duplex. Although this does not appear to have been determined for typically used DNA ligases such as T4, it has been determined for Chlorella Virus DNA ligase and EcoLigA. For Chlorella Virus DNA Ligase, this footprint extends from 89 nucleotides on the 3′-OH side of the nick to 1,112 nucleotides on the 5′-phosphate side of the nick (Odell & Shuman). For EcoLigA, the footprint covers 19 nucleotides and is centered around the nick in the DNA duplex (Nandakumar et al). With this information in mind, the fluor and quencher should be placed no closer than 20 nucleotides from one another.
You can request a quote to discuss the constructs of the FAM and Black Hole Quencher with our Product Management team. We look forward to working with you on this project.
Hi, I just in-vitro transcribed a tRNA with GTPaS instead of normal GTP. I am going to take absorbence at 260 nm but I am not sure how to calculate the extinction coefficient of the RNA with modified non-bridged S. Could you let me know how should I get the correct extinction coefficient?
Thank you.
Hello Tien-Hao,
The alpha thiol modifications do not affect the extinction coefficient. You can use the same calculations you use for standard RNA. The article An Introduction to Extinction Coefficients and Molecular Weights of Oligonucleotides may be helpful. It can be found here: http://www.trilinkbiotech.com/tech/extinction_intro.asp
Kind Regards,
The TriLink Team
Are there any special conditions required for incorporating 4’Uridine-5’triphosphate into a short RNA sequence (I will be using T7 RNA polymerase with a template sequence of about 30 bases preceded by the T7 promoter sequence)?
Thank you.
Dear Charlie,
Thank you for your interest in our modified NTPs. We currently do not offer 4’-modified uridine analogs as a catalog item but offer a 4-Thiouridine-5’-Triphosphate. I was able to find research which used 4-Thio-UTP in transcription reactions.
After reviewing recent literature, Sokoloski et. al. incorporated 4-Thiouridine following the protocol published by McGraw et. al. who used Milligan transcription (1:1 ratio of 4-Thio-UTP and UTP).
If you are interested in a custom synthesis of 4-modified-UTP, please submit your request online. Please let me know if you have any other questions.
Best regards,
Elizabeth
Hi,
Im interested in your biotin-dNTP products. What is the difference (especially in enzymatic incorporation and/or after incorporation as a template for PCR) between Biotin-16-Aminoallyl-2′-dCTP (N-5002) and N4-Biotin-OBEA-2′-deoxycytidine-5′-Triphosphate (N-5004)? I want to incorporate biotin in a primer extension reaction (Klenow), pull down with streptavidin, and then use the biotinylated template for PCR.
Thanks!
Dear Jen,
Thank you for your interest in our Biotin labeled dNTPs. We have documented Biotin-AA-dCTP (N-5002) incorporating at a very high percent substitution for dCTP, up to 97%, in our white paper: PCR incorporation of modified dNTPs: the substrate properties of biotinylated dNTPs. We do not have analagous PCR data on the efficiency of the N4-Biotin-OBEA-dCTP (N-5004), but since the modification is to the N4 nitrogen, it may interfere with Watson-Crick base pairing. Therefore, while this dCTP analog can be incorporated in PCR, the percent substitution for dCTP may not be as high as for Biotin-AA-dCTP.
As you eluded to, different analogs will incorporate in PCR with varying efficiency and some optimization may be needed. We recommend performing some initial PCR experiments using natural:modified dNTPs in ratios such as 1:0, 3:1, 1:1, 1:3 and 0:1 to identify the best conditions for modified nucleotide incorporation with robust amplicon yield.
Kind Regards,
Angela
I need a biotechnologist to answer a few questions via email for my sons 6th grade project. If anyone can help us out please email me Nichole4cm75@yahoo.com…the interview must be completed by Thursday 3/15/12..Thank you in advance for helping my son ..
Hello Nichole,
Absolutely! I will be in touch with you shortly.
Kind Regards,
Angela
Hi,
1. Do you synthesize p33 DNA oligo? 2.What kind of phophorimager is used to detect tridium labled DNA oligo in acrilamide gel? 3. which one more expensive? S35 or H3 DNA oligo?
Dear Dula,
Thank you for your question. We have many years experience in preparing radioactively labeled oligonucleotides. However, we have decided not to carry P33 labeling and focus on isotopic sulfur (35S) and tritium (3H) oligo labeling.
We do not detect tritium labels by gel. Our standard radioactive labeling process includes purification by our double HPLC method, PAGE analysis (of the DNA sequence) and isotopic purity as determined by HPLC. We do not use photoimagers. However, this link may be helpful: http://imagers.salk.edu/pimager/pimFAQ.html It contains a section on Westerns, which describes a special screen to use for tritium detection. Tritium is low energy so you cannot do direct autoradiography.
Pricing is dependent on your construct (backbone, modifications, length) and the final quantity and specific activity you require. We would be happy to discuss your project with you. Please submit a quote request to facilitate further discussion. We look forward to working with you.
Kind Regards,
Angela
How to dry down the RNA quickly? Usually it takes 5 hours in speedvac.
Dear Sathya,
The speed at which your Speed Vac system dries down RNA is more a function of the efficiency of your Speed Vac than it is the RNA. The volume you are trying to dry down coupled with the quality of your Speed Vac system are the most critical aspects of the rate of drying. Speed Vac systems are excellent, but do require considerable maintenance to keep a strong vacuum. We like to see our systems pump down to less than 100 mTorr before they are considered adequate for many of our processes.
In order to maintain a strong vacuum, the pump oil must be kept clean and void of solvents. We change our pump oil at least weekly. All of the vacuum lines must fit tightly and be crack-free. The ice trap should be emptied routinely, since an accumulation of water in the trap will lead to a decrease in the vacuum. The lid of the centrifuge itself must be kept clean. We wipe the seals before each run with ethanol to ensure cleanliness and the maximum seal.
You can also reduce the volume in each individual tube. Aliquot your sample into multiple tubes prior to dry down.
One last suggestion is to go ahead and use the heating function of the Speed Vac centrifuge if yours is so equipped. Just be careful not to let the sample stay in the Speed Vac for any considerable length of time after complete dry down. Try to remove the sample as soon as it is completely dry. Until then the sample is kept cold by the cooling effect of the evaporation of the water.
I hope this helps. If you have any more questions about this, please write or call us.
Best regards,
Richard Hogrefe, Ph.D.
Dear TriLink,
I am looking for an adenosine based modified nucleoside triphosphate that has an amine group that can be used to link an RNA oligo after it is incorporated.
Thank you,
Drew
Dear Drew,
Thank you for your inquiry. While the compound you describe is not a part of our stocked modified nucleotides, if you have a construct in mind, we can prepare the material as a custom chemistry order. If you are interested, please complete a Custom Chemistry Quote Request and our Product Management team will get back to you shortly.
Best regards,
Elizabeth
Hello,
could the following compound become available for purchase from your company
3’thio-guanosine5’triphosphate ?
Dear Brian,
Thank you for your question. The product you requested can be reviewed for a custom job if you’d like to complete a Custom Chemistry Quote Request. In addition, new products are added to our catalog based on customer interest and application. If you’d like to contact us with more details about this compound we can add it to our new ideas.
Best regards,
Elizabeth
Hello,
If you would have a 18 mer oligonucleotide but without the bases so only the phosphodiester backbone is present, would you recommend to purify it as you would do normally with the ones having the bases?
Dear Burcu,
Thank you for your question. The three types of purification routinely used rely on different properties of the oligonucleotide to separate the final product from short fragments and impurities. Depending on what you replaced the bases of your oligonucleotide with, the properties of may be maintained.
If using dSpacer for the entire sequence, all our purification methods are an option.The purification method can be determined based on your desired purity and final application. For more information, see the When is my Oligonucleotide Pure Enough? technical article.
However, if you are interested in the abasic modification, we typically ship abasic modified oligos desalted and in solution as drying down the oligo results in cleavage at abasic sites.
Best regards,
Elizabeth
Dear Natasha,
Follwoing Jia’s question regarding label DNA intercalating dye to nucleotide, I wonder what dyes Trilink use to provide this service. Can you label most of the SYTO family dyes (blue, organe, red and green) as well as the monomeric and dimeric dyes of PO, BO, TO, JO YO?
Thanks!
AC
Dear AC,
Thank you for your inquiry. TriLink has the ability to incorporate any commercially available dye into an oligo as long as it is available as an amidite or NHS ester. Esters can be conjugated to our internal C6 amino modified bases, while amidites can be incorporated directly into the oligo. Since each synthesis is unique, each request must be reviewed and quoted on a case by case basis to ensure synthesis compatibility and quote accuracy.
Unfortunately we are not familiar with the monomeric and dimeric dyes that you mentioned in your inquiry, and it appears that the SYTO family is made up of stains rather than dyes used during oligo synthesis. We are typically willing to work with or analyze dyes not offered in our catalog, as long as they are commercially available. If you have any questions about a specific dye’s usage do not hesitate to contact us by email at sales@trilinkbiotech.com.
Thank you,
Jonah
Dear Sir/ Madam,
Are you able to label DNA intercalating dye (e.g. Thiazole Orange) to nucleotides?
Thanks
Jia Jun Lee
Dear Jia,
Yes, we are able to label DNA intercalating dye (e.g. Thiazole Orange) to nucleotides. Using TriLink’s custom synthesis service, we can conjugate your dye of choice to dNTPs containing the appropriate linker. Typically conjugations are performed to dCTP or dUTP nucleotides which contain linkers such as aminoallyl (CAT#s N-2048 and N-2049, respectively). To learn more about this service, please visit: http://www.trilinkbiotech.com/products/chemistry/polyphosphates.asp
Thank you,
Natasha
Dear Trilink,
I was wondering whether you have any idea about the resistance of an 80 bp long RNA strand containing 5-aminoallyl-2′-cytidine modifications to heating? I elute the modified RNA fragment from a denaturing PAGE gel and concentrate the eluted sample down from 1.2 ml to 100 micoliters on a speedvac. As this is very time consuming, I was wondering till what temperature I could heat the modified RNA during this process.
Thank you very much in advance,
Yours sincerely,
Marleen
Dear Marleen,
The aminoallyl moeity should not affect the stability of the RNA to heating. The main point for breakdown of the RNA is the phosphodiester backbone, which is prone to degradation in the presence of divalent metals, basic pH, and heat. We recommend heating to the same temperatures used for unmodified RNA. We suggest an ethanol precipitation to concentrate your RNA, followed by a 70% ethanol wash. We assume there is EDTA present from the PAGE gel, which should help protect the RNA. Keep in mind that when you concentrate the RNA you are also concentrating any salts that are present. We always keep the supernatants until we are sure we have a good recovery. If recovery is poor, you can respin the supernatants. We hope your project goes well and feel free to contact us anytime.
Hi,
I am trying to extract 2’Omethyl modified oligos from serum/plasma. Some of my oligos may behave more like DNA, because they are fully 2’Omethyl modified. What would be the best way of extraction from serum/plasma???
Thank you for your help!!!
regards
Luiza
Hello Luiza,
Thank you for your inquiry. We would suggest starting with a phenol/chloroform extraction followed by an isopropanol precipitation and a 70% ethanol wash. Although we are not aware of any 2′-OMe oligonucleotide pharmacokinetic publications that would have information along the lines requested. There are many publications by Isis and collaborators on 2′-MOE oligonucleotides, which are analogous, albeit with some phosphorothioates and only partial 2′-MOE modification. The methods used and cited their publication Phase I trial of ISIS 104838, a 2′-methoxyethyl modified antisense oligonucleotide targeting tumor necrosis factor-alpha could also be consulted for your purposes. Please feel free to send any follow-up questions you may have.
Best Regards,
Angela
Hi,
I want to synthesize a modified mRNA using a invitro transcription system. I use 5-methylcytidine triphosphate(Trilink N1019) and pseudouridine triphosphate(Trilink N1014) instead of CTP and UTP respectively to make this particular mRNA (use ATP, GTP, 5mCTP and ψTP as the substrate).
The yield is very low (only 2ug products in 20uL reaction). However, the yield of control group (use ATP, GTP, CTP and UTP as the NTPs as the substrate) is very high (up to 50ug of mRNA products in 20uL reaction).
Could you help me why the invitro transcription yield dropped dramatically when i replace CTP ＆UTP instead of 5mCTP ＆ψTP?
Thanks a lot!
Dear Peizhe,
We typically do not see a significant decrease in the yield when we substitute pseudo U and 5 methyl C for WT NTPs. Have the vials of pseudo U and 5 methyl C undergone many freeze thaw cycles? We recommend aliquoting the modified NTPs at the first thaw to avoid repeated freeze thaw cycles. It is also possible that the one of the modified NTPs has become contaminated with RNases. If this is the case, addition of the modified NTP to a reaction containing all four unmodified NTPs might show decreased yield. Please give me a call for any additional discussions.
Best regards,
Anton McCaffrey, PhD
800 863-6801
I was wondering if that is correct I add up two complementary oligos’ MW and use that as annealed oligos’ MW.
Dear Cindy,
Thank you for your inquiry. Yes, the molecular weight of a duplex can be determined by adding the molecular weights of the individual strands.
The characteristic that is not additive for a duplex is the extinction coefficient which can be 15-25% lower than the combined extinction coefficients due to the hyperchromicity of the duplex. The adjusted extinction coefficient can be found using the following formula:
(measured ODs/Total ODs of single strands) x Total Extinction Coefficient = Duplex Extinction Coefficent
Best regards,
Liz
Hi:
My name is Francisco Hernandez- Torres. Recently I have joined, as a postdoc, to Diego Francos’s Lab in the University of Jaen (Spain). Curently, we are interested in the study of some microRNAs biogenesis. The question is, coud it be posible to sinthesize a RNA oligo of 60-90 nucleotides long? In adition, coud it be posible to label some inner selected nucleotides as we desire?
Thank you
Francisco
Dear Francisco,
Thank you for your interest in TriLink. Yes, we can synthesize a 60-90mer RNA oligonucleotide. We have successfully made up to a 110mer unmodified RNA oligonucleotide and continue to try longer sequences as our customer’s request them. Yes, internal modifications can be incorporated. Click here for a full list of our oligonucleotide modifications. If you do not see what you are looking for, please let us know. Typically if a modification is commercially available, we can incorporate it for you. To request a quote click here, to build your oligonucleotide go to OligoBuilder®. We look forward to working with you.
Best Regards,
Angela
I was wondering if the following modified nucleotides can be used by Taq polymerase in PCR.
1-Thio-2′-Deoxyadenosine-5′-Triphosphate (N-8001)
1-Thio-2′-Deoxycytidine-5′-Triphosphate (N-8002)
Thank you,
Dear Chun-Nan,
Thank you for your interest in TriLink. 1-Thio-2′-Deoxyadenosine-5′-Triphosphate (N-8001) and 1-Thio-2′-Deoxycytidine-5′-Triphosphate (N-8002) can be incorporated by Taq in PCR. However, not all analogs will incorporate with the same efficiency in PCR; some optimization may be needed. We recommend performing some initial PCR experiments using natural:modified dNTPs in ratios such as 1:0, 3:1, 1:1, 1:3 and 0:1 to identify the best conditions for modified nucleotide incorporation with robust amplicon yield.
Kind Regards,
Angela
Pingback: » Oligo/Dye Linker Selection
Hi,
I need a DNA oligo with a fluorescent dye attached for an fluorescence polarization assay. The linker between DNA and dye should be as rigid as possible and the dye most likely a BODIPYdye, dansyl or fluorescein dye. Attachement either internal or at the 5′ of the oligo.
What solution do you have for that?
Dear Chris,
Thank you for your interest in TriLink BioTechnologies. A shorter linker will provide the most rigidity between an oligo and a dye. Our shortest linker is the dT-C2 amino linker. The linker arm is attached to the Thymidine base and the dye would be conjugated onto the amino group post-synthetically.
Another option would be to use our C7 internal amino linker. This linker provides a short 4 carbon chain extending from the backbone of the oligo. This linker can be incorporated between nucleotides and will not add another base to your oligo, unlike the dT-C2 amino linker. As far as the dye is concerned, FAM typically couples better than the BODIPY or Dansyl dyes and will most likely provide a better quality final product.
We do not know how the length of the linker will affect your specific application. The shorter linkers will provide a more rigid incorporation of the dye, but these may not be an option if you need the dye further from the oligo than these linkers can allow. Please let us know if you have any further questions or would like to explore any other options. Thank you.
Jonah
Hi – I just wondered if it is possible to buy NTP’s (in particular ATP) that works like the CleanAMP nucleotides. A preferable version would be activated by light, but is probably impossible to get! Any opinion on this would be appreciated very much!
Thank you for your inquiry. The CleanAmp™ modification can be introduced onto a number of NTP analogs, including ATP. This would allow you to control activation via pH or heat. There are other approaches to introduce light activatable modifications onto ATP as well. TriLink specializes in unique nucleic acid modifications and we look forward to learning more about how we can support your research. Please contact us to request a quote and discuss your project further.
Hi,
I left deprotected sulfhydyl modified oligomers on dry ice overnight, but found the ice had evaporated overnight. I don’t know how long they sat at RT before I got to them. Are they ruined? How fast is dimerization reaction?
Thanks,
Scr33ble
Thank you for your inquiry. We do not believe your thiol oligomer was ‘ruined’ by this exposure. Your next steps depend upon whether your oligonucleotide was in solution or lyophilized. If it was lyophilized, a simple reduction step will eliminate any dimers. Here is the protocol:
1. Make a solution of 60 mM TCEP. (18 mgs TCEP in 1 mL H2O) 2. Add 125 uL 0.1M NaHPO4, 0.15M NaCl, pH 7.26, vortex & make certain oligo is in solution.
3. Add 75 uL 60 mM TCEP to oligo solution.
4. Vortex.
5. Let sit for 2 hrs at room temperature.
6. Run size exclusion column, RP-HPLC
If your oligonucleotide was in solution, we recommend doing a small test reaction to ensure the material is still functional. Please feel free to submit any additional questions by writing a comment below or emailing us at support@trilinkbiotech.com.
Pingback: » Conditions of Lyophilized Oligonucleotides In Vitro
I would like to know what condition (and aqueous solution) you recommend for suspension of the lyophilized oligos for in vitro use?
Dear Michael,
Thank you for your question. Prior to resuspending your oligo be sure to centrifuge it briefly to ensure all product is down in the bottom of the tube. We recommend bringing your oligo up in any aqueous solution with a neutral pH. If you use just water, be sure that it is nuclease free. We also suggest aliquotting your oligo into one-time usage amounts to avoid multiple freeze-thaw sessions. If you have any further questions please do not hesitate to contact us.
Best Regards,
Angela
Pingback: » CleanAmp™ dNTP Activation
How long it take to activate CleanAmp dNTPs at 95C and 60C?
Dear Dr. Wang,
Thank you for your interest in TriLink. CleanAmp™ dNTPs have a t 1/2 of 40 minutes at 95°C. We are currently developing new, improved version of CleanAmp™ dNTPs that have a t 1/2 of 7 minutes. We are also working towards an isothermal solution, but have found some inherent challenges in finding the right balance of product stability and activation of the leaving group. We may have a chemistry that would work for your application or our custom chemistry team could synthesize a unique chemistry for you. Please contact Shawna Leaver, our Custom Chemistry Product Manager, through info@trilinkbiotech.com or 1-800-863-6801. You can also submit your quote online by clicking here.
We look forward to working with you.
Angela
I’d like to know the recommended condition to dissolve the synthesized TRIMER oligos?? Is it better to use TE buffer, pH 8 or just DDI water?
Dear Dr. Xiang,
Thank you for your question. We recommend resuspending oligonucleotides in aqueous, neutral solution. It would be best to resuspend your trimer oligonucleotide in DDI water. If you have any further questions, please do not hesitate to contact us.
Kind Regards,
Judy
Do you have any CleanAmp products that were determined to be product “failures” during your development? I know you made products with a hot start at high temperature a goal but do you have any chemistries that activated at ~56oC and were never released as viable product? Customized chemistries are of interest for ongoing development in my organization with an activation temp ~56oC.
Thanks, Dan Shaffer
Dear Dr. Shaffer,
Thank you for your interest in our CleanAmp™ Products. We did, as you thought, try several protecting groups before landing on the current CleanAmp™ chemistry. We are also working towards an isothermal solution, but have found some inherent challenges in finding the right balance of product stability and activation of the leaving group. We may have a chemistry that would work for your application or our custom chemistry team could synthesize a unique chemistry for you. Please contact Shawna Leaver, our Custom Chemistry Product Manager, through info@trilinkbiotech.com or 1-800-863-6801. You can also submit your quote online by clicking here.
We look forward to working with you.
Angela